Dataset for CDS BCL-2 of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2HRY3_BCL2-02      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaa
A0A3Q2HRY3_BCL2-01      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaa
                        **************************************************

A0A3Q2HRY3_BCL2-02      gtacatccactataagctgtcgcagaggggctacgagtgggatgccggag
A0A3Q2HRY3_BCL2-01      gtacatccactataagctgtcgcagaggggctacgagtgggatgccggag
                        **************************************************

A0A3Q2HRY3_BCL2-02      acgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcc
A0A3Q2HRY3_BCL2-01      acgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcc
                        **************************************************

A0A3Q2HRY3_BCL2-02      tcccagcccgggcgcacccccgcgcccgccaggacctccccgctgctacc
A0A3Q2HRY3_BCL2-01      tcccagcccgggcgcacccccgcgcccgccaggacctccccgctgctacc
                        **************************************************

A0A3Q2HRY3_BCL2-02      cccggccgcccccgccggcgccgcgggacctgccctcagccctgtgccac
A0A3Q2HRY3_BCL2-01      cccggccgcccccgccggcgccgcgggacctgccctcagccctgtgccac
                        **************************************************

A0A3Q2HRY3_BCL2-02      ctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgc
A0A3Q2HRY3_BCL2-01      ctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgc
                        **************************************************

A0A3Q2HRY3_BCL2-02      taccgccgcgactttgccgagatgtccagccagctgcacctgacgccttt
A0A3Q2HRY3_BCL2-01      taccgccgcgactttgccgagatgtccagccagctgcacctgacgccttt
                        **************************************************

A0A3Q2HRY3_BCL2-02      caccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
A0A3Q2HRY3_BCL2-01      caccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
                        **************************************************

A0A3Q2HRY3_BCL2-02      gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatg
A0A3Q2HRY3_BCL2-01      gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatg
                        **************************************************

A0A3Q2HRY3_BCL2-02      tgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgc
A0A3Q2HRY3_BCL2-01      tgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgc
                        **************************************************

A0A3Q2HRY3_BCL2-02      cctgtggatgactgaatacctgaaccggcacctgcacacctggatccagg
A0A3Q2HRY3_BCL2-01      cctgtggatgactgaatacctgaaccggcacctgcacacctggatccagg
                        **************************************************

A0A3Q2HRY3_BCL2-02      ataacggaggctgg--caactttgccaagcaccaacaggctctcaggaaa
A0A3Q2HRY3_BCL2-01      ataacggaggctgggacgcctttgt---ggaactgtacggccccagca--
                        **************  *  *****    * * *   * *  * *** *  

A0A3Q2HRY3_BCL2-02      tgttcagcggtgggtggaccattcattctggctctccattgcagaatctt
A0A3Q2HRY3_BCL2-01      -----tgcggccgctgtttgatttctcctggctgtctct-----------
                              ****  * **    ***  * ****** **  *           

A0A3Q2HRY3_BCL2-02      tgtgtgtcaagggcaggaaattggttttcagagaagaaaaatatga-ctt
A0A3Q2HRY3_BCL2-01      ----------------gaaggcgctgctcag----------tctggccct
                                        ***   * *  ****          * **  * *

A0A3Q2HRY3_BCL2-02      ggtgtttaacttcagacaaggatgtaatcgacaggacacccatccgcatg
A0A3Q2HRY3_BCL2-01      ggtg-----------------------------gga---------gcttg
                        ****                             ***         ** **

A0A3Q2HRY3_BCL2-02      tatcagggaaggaagagtagagaggcagaaatacaaagccagtgcagacc
A0A3Q2HRY3_BCL2-01      catca------------------------------------------ccc
                         ****                                           **

A0A3Q2HRY3_BCL2-02      tccgtgcatgctgctgcacctgctggaaatccaggttccagttctgtttc
A0A3Q2HRY3_BCL2-01      tgggtgcct-------------------atctgggccaca----------
                        *  **** *                   ***  **   **          

A0A3Q2HRY3_BCL2-02      tcagtgagtaa
A0A3Q2HRY3_BCL2-01      ------agtga
                              *** *

© 1998-2019