Dataset for CDS BCL-2-like of organism Dicentrarchus labrax

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1X9JZA1_BCL2-01      atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgccataa
E6ZFR0_BCL2L1-01        atgtcgtaca---gtaacagagagctggtggagttctttataagctataa
                        *** ** **    ****  *  *  * *****    * ***  ** ****

A0A1X9JZA1_BCL2-01      actctccaaacagggcta----------cgagtgggggtttgacgctgtc
E6ZFR0_BCL2L1-01        actgtctcagaggaaccacccaacctctctactgagg------------c
                        *** **  *   *  * *          * * ** **            *

A0A1X9JZA1_BCL2-01      cg--gaatgcagatgccggtaataatgg-gtcaatagttgcccctccacc
E6ZFR0_BCL2L1-01        cggagaatgccggtgaaaggactgagggagacaaggccaactcagctgcc
                        **  ****** * **   * * * * ** * ***      * *  *  **

A0A1X9JZA1_BCL2-01      gagtttggtccgccggtgccgtggagccagcaccgggcccgacag-cgag
E6ZFR0_BCL2L1-01        agaaacggcttgctggc------cagcaagaacacaagtggccagccggg
                              **   ** **        *** ** **       * *** ** *

A0A1X9JZA1_BCL2-01      agcatcccccacctctgcacacggctcccccagtccgacccgcatgccgc
E6ZFR0_BCL2L1-01        gacgtcttcgtcctcag---gcg-----------ctgacatagaggctgt
                          * **  *  **** *    **           * ***    * ** * 

A0A1X9JZA1_BCL2-01      catccacagagtcctacgcgaggctggagacgaacttgaaagactgtacc
E6ZFR0_BCL2L1-01        aa---aggcagctcttcgggactcggcagatgagtttgaactgctcttca
                         *   *   **  ** ** **  * * *** **  *****   ** * * 

A0A1X9JZA1_BCL2-01      agccggacttcacggagatgtcgcggcagctgtatctcacctccaccacg
E6ZFR0_BCL2L1-01        cgcaagcgtttagtgacctttcctcgcagattgacatcactcctgacacg
                         **  *  ** *  **  * **   **** *  *  ****  *   ****

A0A1X9JZA1_BCL2-01      gcgcagaggagattcgccgacgtgatagacgaactgttccgggacggggt
E6ZFR0_BCL2L1-01        gcctaccacagctttaaaagcgtgatggacgaggtgttcaaggatggagt
                        **  *    ** **      ****** *****  *****  *** ** **

A0A1X9JZA1_BCL2-01      gaactggggccggattatcgctttcttcgagttcgggggcacggtgtgcg
E6ZFR0_BCL2L1-01        gaactggggacgtatagtgggcctgtttgcctttggcggtgtactgtgtg
                        ********* ** **  * *   * ** *  ** ** **     **** *

A0A1X9JZA1_BCL2-01      tggagtgcgtggcgaaggaggagatggcagcgcaggtgaacaacatcgcg
E6ZFR0_BCL2L1-01        tagaatgtgtcg---agaaagatatgagtgagctggtttcccgcatcgca
                        * ** ** ** *   ** * ** ***   * ** ***   *  ****** 

A0A1X9JZA1_BCL2-01      gagtggatgactgagtatttaaatggacctctgaacagctggatacaaga
E6ZFR0_BCL2L1-01        gactggatgaccatgtacctggatgagcacatcagtccgtggatccagag
                        ** ********   ***  *  ***  *   * *     ***** **   

A0A1X9JZA1_BCL2-01      taacgggggatgggatgcctttgtggagctgtatgacagacagagggact
E6ZFR0_BCL2L1-01        ccaaggaggatgggactgctttgctgaggtttttg------ggcgagacg
                          * ** ********   *****  *** * * **       * * *** 

A0A1X9JZA1_BCL2-01      ccgtcttcagttg---------ctcctggccctccattaagacgg----t
E6ZFR0_BCL2L1-01        ccg-ccgcagaagcgaggagatctcgggagactctgagtagatggctgct
                        *** *  ***  *         ***  *   ***     *** **    *

A0A1X9JZA1_BCL2-01      cttcggtgtggctgcgcttggagcagctagcctcaccatcggagcgtacc
E6ZFR0_BCL2L1-01        aattggggtggcgctgctaatgggagct------gtggtcggggttctca
                          * ** *****   ***    * ****          **** *    * 

A0A1X9JZA1_BCL2-01      ttacacagaag---tga
E6ZFR0_BCL2L1-01        ttgctaagaaacattga
                        ** *  ****    ***

© 1998-2019