Dataset for CDS MCL-1 of organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F8W4Q8_MCL1-02      ------------------------------------at----------------------
Q8UWD6_MCL1-01      ------------------------------------atg------ttcgctggaag----
F8W4Q8_MCL1-01      ------------------------------------atg------ttcgctggaag----
Q568W5_MCL1-01      ------------------------------------atg------ttcgctggaag----
Q568V1_MCL1-01      ------------------------------------atgagcttcctcgcgcagggcgtt
Q1L8X3_MCL1-01      atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgcgcagggcgtt
Q9I9N3_MCL1-01      atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgcgcagggcgtt
                                                        **                      

F8W4Q8_MCL1-02      ------------------------------------------------------------
Q8UWD6_MCL1-01      -aaacaacgac------aacggcttttggccatgcactggat---tacaaagcaaaccac
F8W4Q8_MCL1-01      -aaacaacgac------aacggcttttggccatgcactggat---tacaaagcaaaccac
Q568W5_MCL1-01      -aaacaacgac------aacggcttttggccatgcactggat---tacaaagcaaaccac
Q568V1_MCL1-01      caaactccgacgctgaagacgtgcgtcgaagacgaactggacgggtacattgaggaggag
Q1L8X3_MCL1-01      caaactccgacgctaaagacgtgcgtcgaagacgaactggacggatacattgaggaggag
Q9I9N3_MCL1-01      caaactccgacgctaaagacgtgcgtcgaagacgaactggacggatacactgaggaggag
                                                                                

F8W4Q8_MCL1-02      ------------------------------------------------------------
Q8UWD6_MCL1-01      tggttattccagaa------ctgaaagcgcataaccagtttg-----------------c
F8W4Q8_MCL1-01      tggttattccagaa------ctgaaagcgcataaccagtttg-----------------c
Q568W5_MCL1-01      tggttattccagaa------ctgaaagcgcataaccagtttg-----------------c
Q568V1_MCL1-01      gaggcgcctctgaagcggcttagacctggtacaaacggcctgaaggggctgcagctggac
Q1L8X3_MCL1-01      gaggcgcctctgaagcggcttagaccgggtacaaacggcctgaaggggctgcagctggac
Q9I9N3_MCL1-01      gaggcgcctctgaagcggcttagaccgggtacaaacggcctgaaggggctgcagctggac
                                                                                

F8W4Q8_MCL1-02      ----gattctct------------------------------------------------
Q8UWD6_MCL1-01      ggtggactctctcc--------agggctcggtaccgtcctcgccttcggacgaaacgggg
F8W4Q8_MCL1-01      ggtggactctctcc--------agggctcggtaccgtcctcgccttcggacgaaacgggg
Q568W5_MCL1-01      ggtggactctctcc--------agggctcggtaccgtcctcgccttcggacgaaacgggg
Q568V1_MCL1-01      ggtcgatttgtttctacgacagacggatctctaccgaccacccc------agatccagag
Q1L8X3_MCL1-01      ggtcgatttgtttctgcgacagacggatctctaccgaccacccc------agatccggag
Q9I9N3_MCL1-01      ggtcgatttgtttctgcgacagacggatctctaccgaccacccc------agatccggag
                        ** *   *                                                

F8W4Q8_MCL1-02      ------------------------------------------------------------
Q8UWD6_MCL1-01      gattatccccccaccgcccttgacatggacacgcgggagattattgacactttcttaaaa
F8W4Q8_MCL1-01      gattatccccccaccgcccttgacatggacacgcgggagattattgacactttcttaaaa
Q568W5_MCL1-01      gattatccccccaccgcccttgacatggacacgcgggagattattgacactttcttaata
Q568V1_MCL1-01      gagctcgactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgc
Q1L8X3_MCL1-01      gagctcgactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgc
Q9I9N3_MCL1-01      gagctcgactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgc
                                                                                

F8W4Q8_MCL1-02      ---------ggactctttc-----------------------------------------
Q8UWD6_MCL1-01      atctttacaggactccctcattctaaaagtggacgaaaacaagtactgtcaacaatgagg
F8W4Q8_MCL1-01      atctttacaggactccctcattctaaaagtggacgaaaacaagtactgtcaacaatgagg
Q568W5_MCL1-01      atctttacaggactccctcattctaaaagtggacgaaaacaagtactgtcaacaatgagg
Q568V1_MCL1-01      acacacacgggaatgtgtccggtagaccgtaaactccatcacgccataccgacgatgaag
Q1L8X3_MCL1-01      acacacacgggaatgtgtccggtagaccgtaaactccatcacgccataccgacgatgaag
Q9I9N3_MCL1-01      acacacacgggaatgtgtccggtagaccgtaaactccatcacgccataccgacgatgaag
                             *** *   **                                         

F8W4Q8_MCL1-02      --------------------------------------------aggtatgattgcacgg
Q8UWD6_MCL1-01      cgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaaggtatgattgcacgg
F8W4Q8_MCL1-01      cgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaaggtatgattgcacgg
Q568W5_MCL1-01      cgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaaggtatgattgcacgg
Q568V1_MCL1-01      cgggtggtcgacaatattctcgtgaagcaccagatcgcatacaaaggaatgatccagcgt
Q1L8X3_MCL1-01      cgagtggtcgacaatattctcgtgaagcaccagatcgcatacaaaggaatgatccagcgt
Q9I9N3_MCL1-01      cgagtggtcgacaatattctcgtgaagcaccagatcgcatacaaaggaatgatccagcgt
                                                                *** *****    ** 

F8W4Q8_MCL1-02      ctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctc
Q8UWD6_MCL1-01      ctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctc
F8W4Q8_MCL1-01      ctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctc
Q568W5_MCL1-01      ctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctc
Q568V1_MCL1-01      cttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatg
Q1L8X3_MCL1-01      cttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatg
Q9I9N3_MCL1-01      cttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatg
                    **  * *****     *    *    * *    *******      * ****      * 

F8W4Q8_MCL1-02      tttagcgatggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatg
Q8UWD6_MCL1-01      tttagcgatggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatg
F8W4Q8_MCL1-01      tttagcgatggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatg
Q568W5_MCL1-01      tttagcgatggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatg
Q568V1_MCL1-01      tttaaagatggcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtg
Q1L8X3_MCL1-01      tttaaagatggcgtcactaactggggccgaattgcgagtctggtggcgttcggggccgtg
Q9I9N3_MCL1-01      tttaaagatggcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtg
                    ****  ******  *** ******** ** ** ** ** *** ** * ** *****  **

F8W4Q8_MCL1-02      ctgtgcaaataccagaatgacagag----gacatagcaagtatgtgaggttggtagggga
Q8UWD6_MCL1-01      ctgtgcaaataccagaatgacagag----gacatagcaagtatgtgaggttggtagggga
F8W4Q8_MCL1-01      ctgtgcaaataccagaatgacagag----gacatagcaagtatgtgaggttggtagggga
Q568W5_MCL1-01      ctgtgcaaataccagaatgacagag----gacatagcaagtatgtgaggttggtagggga
Q568V1_MCL1-01      gtttgc----tctcgattgaaggagctccagcaggatcagtgtgtggagagagtggctga
Q1L8X3_MCL1-01      gtttgc----tctcgattgaaggagctccagcaggatcagtgtgtggagagggtggctga
Q9I9N3_MCL1-01      gtttgc----tctcgattgaaggagctccagcaggatcagtgtgtggagagggtggctga
                     * ***     *  ** ***  ***      **     *** ****  *   ** *  **

F8W4Q8_MCL1-02      ggagatctcgtcttatctacttacagagcagcgggactggatactcagaaacaaagcatg
Q8UWD6_MCL1-01      ggagatctcgtcttatctacttacagagcagcgggactggatactcagaaacaaagcatg
F8W4Q8_MCL1-01      ggagatctcgtcttatctacttacagagcagcgggactggatactcagaaacaaagcatg
Q568W5_MCL1-01      ggagatctcgtcttatctacttacagagcagcgggactggatactcagaaacaaagcatg
Q568V1_MCL1-01      gcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaaacaagagctg
Q1L8X3_MCL1-01      gcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaaacaagagctg
Q9I9N3_MCL1-01      gcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaaacaagagctg
                    * ******* ** *****     **** **** ********* **** ******    **

F8W4Q8_MCL1-02      ggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacact
Q8UWD6_MCL1-01      ggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacact
F8W4Q8_MCL1-01      ggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacact
Q568W5_MCL1-01      ggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacact
Q568V1_MCL1-01      tcatgggttcgtggagtttttccaccaggaggacgtagagtctgttgtccgtcatggtct
Q1L8X3_MCL1-01      gcatgggttcgtggagtttttccaccaggaggacgtagagtctgttgtccgtcatggtct
Q9I9N3_MCL1-01      gcatgggtttgtggagtttttccaccaggaggatgtagagtctgttgtccgtcatggtct
                      **** ** *********** **      ***   **** * * ***  *  *    **

F8W4Q8_MCL1-02      tctaacaattggtgg-tgtggctacattaagtgcagcacttgcctattggatacggtga
Q8UWD6_MCL1-01      tctaacaattggtag-tgtggctacattaagtgcagcacttgcctattggatacggtga
F8W4Q8_MCL1-01      tctaacaattggtgg-tgtggctacattaagtgcagcacttgcctattggatacggtga
Q568W5_MCL1-01      tctaacaattggtgg-tgtggctacattaagtgcagcacttgcctattggatacggtga
Q568V1_MCL1-01      gttggcgctggtcggatgtgccggtatc-ggcgccggtctggccttcctcatccggtga
Q1L8X3_MCL1-01      gttggcgctggtcggatgtgccggtatc-ggtgccggtctggccttcctcatccggtga
Q9I9N3_MCL1-01      tttggcgctggtcggatgtgccggtatc-ggtgccggtctggccttcctcatccggtga
                      *  *  * *   * **** *   **   * ** *  ** ****     ** ******

© 1998-2018