Dataset for CDS BCL2L1 of organism Cyprinodon variegatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2C6K4_BCL2L1-      atgtcatacagtaacagagaactggtagagttctatataagctacaaact
A0A3Q2FR43_BCL2L1-      atgtctca---gaacagagaactggtccttttctacattaagttcaaact
                        *****  *    **************    ***** ** *  * ******

A0A3Q2C6K4_BCL2L1-      gtctcagacaaactgccca-----------aactctctgctgag--gtcg
A0A3Q2FR43_BCL2L1-      gtctcagaggaactatcccgtcaaccacataatgctcaac-gagccgccc
                        ********  ****  **            **  ***  * ***  * * 

A0A3Q2C6K4_BCL2L1-      gaggtcactggtggccggaccgagggagacaaggacgcctcggcttccag
A0A3Q2FR43_BCL2L1-      aacggcaccggcgcccag---ggggcggagcaggacgacg-agcgtacgc
                         * * *** ** * ** *   * **  **  ****** *   ** * *  

A0A3Q2C6K4_BCL2L1-      caatggcccac----------ttttcaacag---caggcccagccccccc
A0A3Q2FR43_BCL2L1-      cggagacgcacgctaacgggacttttaacgggaccagtccaggctccccg
                        *   * * ***           *** *** *   *** **  ** **** 

A0A3Q2C6K4_BCL2L1-      gggaagcctcgggccccccatggaagcatagaggctgtaaaatccgctct
A0A3Q2FR43_BCL2L1-      cggcgacagcaggcgtccacagccgccatggaggcggtgaaggcggcgct
                         **   *  * ***  **   *    *** ***** ** **  * ** **

A0A3Q2C6K4_BCL2L1-      gaaggactcagcaaatgagtttgaacttctcttctctcaaagtttcagtg
A0A3Q2FR43_BCL2L1-      gagagacacggcctgcgagttcgagctgcgctacgcccgcgccttcaacg
                        **  *** * **    ***** ** ** * ** * * *     ****  *

A0A3Q2C6K4_BCL2L1-      acctctccatgcagctagacatcacccctgacacggcctaccacagcttt
A0A3Q2FR43_BCL2L1-      accttcacagcacgctgcacatcacgccggccaccgcctaccagagcttc
                        ****   **    ***  ******* ** * *** ******** ***** 

A0A3Q2C6K4_BCL2L1-      aaggccgtgttggacgagttgttcaaggatgggatcaactggggccgtgt
A0A3Q2FR43_BCL2L1-      gagaacgtgatgaacgaggtgttccgggacggcgtcaactggggccgcat
                         **  **** ** ***** *****  *** **  *************  *

A0A3Q2C6K4_BCL2L1-      ggtggggctgtttgcctttggtggggttctgtgtgtgcactgcgtgcaga
A0A3Q2FR43_BCL2L1-      cgtgggcctgttcgccttcggcggagcgctgtgcgtggaatgcgtggaga
                         ***** ***** ***** ** ** *  ***** *** * ****** ***

A0A3Q2C6K4_BCL2L1-      agaatatgagtgagttggtgtcccgcattgcagactggatgaccatttac
A0A3Q2FR43_BCL2L1-      aggagatgagtcccctggtggggcggatcgtggagtggatgaccgtctac
                        ** * ******    *****   ** ** *  ** ********* * ***

A0A3Q2C6K4_BCL2L1-      ctagatgagcagcttaacccttggatccacagccagggaggatgggactg
A0A3Q2FR43_BCL2L1-      ttggatgagcagatcgatccctggatccagagccaaggaggatgggaacg
                         * ********* *  * ** ******** ***** ***********  *

A0A3Q2C6K4_BCL2L1-      ctttgctaagctgtacggccaagacgccgctgcagaggggcggagatctc
A0A3Q2FR43_BCL2L1-      ctttgctgaaatcttcggaggcgacgcagcggctgagagcagaaggtctc
                        ******* *  * * ***    ***** ** ** *** *  * ** ****

A0A3Q2C6K4_BCL2L1-      acgagacattgaacaaatggctgctagttggtgcggctctgctcggcgga
A0A3Q2FR43_BCL2L1-      aggagagcctgaagaactggctgctgctggggatgagcgtggccaccgcc
                        * ****   **** ** ********  * **   *    **  *  **  

A0A3Q2C6K4_BCL2L1-      gttctgctcactgtgcttgttgctaagaaacg---atga
A0A3Q2FR43_BCL2L1-      ctcatagccggctccatcttcgcccacaaacgcctgtga
                         *  *   *       *  * **  * *****    ***

© 1998-2019