Dataset for CDS BCL-2-like of organism Cricetulus griseus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


B2Z3Z4_BCL2L1-01      atgtctcag------------------agcaaccgggagctagtggttga
Q9JJV8_BCL2-01        atggctcaagctgggagaacagggtatgataaccgagagatcgtgatgaa
                      *** ****                      ***** *** * *** *  *

B2Z3Z4_BCL2L1-01      ctttctctcctacaagttctcccagaaaggatacagctggagtcagttta
Q9JJV8_BCL2-01        gtacatccattataagctgtcacagaggggctacgagtgg----------
                       *   **   ** *** * ** ****  ** ***   ***          

B2Z3Z4_BCL2L1-01      gtgatgtcgaagagaacaggactgaggccccagaaggaactgaatcagag
Q9JJV8_BCL2-01        --gatgtgggagatgtggacgccgcgcccct-------------------
                        ***** * ***        * * * ***                    

B2Z3Z4_BCL2L1-01      agggagacccccagtgccatcaatggcaacccatcctggcacctggcgga
Q9JJV8_BCL2-01        -gggcgccgccc----ccacccctggcatcttctccttccagcctgagag
                       *** * * ***    *** *  ***** *   ****  ** *  * *  

B2Z3Z4_BCL2L1-01      cagc------cccgcggtaaatggagccactg--gccacagca--gcagt
Q9JJV8_BCL2-01        caacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccac
                      ** *      ***** **  *  * * **  *  ****   **  **   

B2Z3Z4_BCL2L1-01      ttggatgcacgggag-----------------gtgatccccatggcagcc
Q9JJV8_BCL2-01        taaggcccatagtcgccaccactgggcctacccttagccccgtgccacct
                      *  *   **  *  *                  * * **** ** ** * 

B2Z3Z4_BCL2L1-01      gtaa---agcaagcgctgagagaggccggcgatgagtttgagctgcggta
Q9JJV8_BCL2-01        gtggtccacctgaccctccgccgggctggggatgacttctcccgtcgcta
                      **     * *   * **  *   *** ** ***** **    *  ** **

B2Z3Z4_BCL2L1-01      ccggcgggcgttcagtgatctaacatcccagcttcatataaccccaggga
Q9JJV8_BCL2-01        ccgtcgcgacttcgcggagatgtccagtcagctgcacctgacgcccttca
                      *** ** *  ***   **  *  *    ***** **  * ** **    *

B2Z3Z4_BCL2L1-01      ctgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatggg
Q9JJV8_BCL2-01        ccgcgaggggacgctttgctacggtggtggaggaactcttcagggatggg
                      * **      * ******    *** *** * ********* ********

B2Z3Z4_BCL2L1-01      gtaaactggggtcgcattgtggcctttttctccttcggtggagccctctg
Q9JJV8_BCL2-01        gtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtg
                      ** ********  * *********** **    ******** * * * **

B2Z3Z4_BCL2L1-01      tgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcaa
Q9JJV8_BCL2-01        tgtggagagcgtcaacagggagatgtcacccctggtggacaacatcgccc
                      ****** *****  *** *******       *****      *****  

B2Z3Z4_BCL2L1-01      gttggatggccacctacctgaatgaccacctagagccttggatccaggac
Q9JJV8_BCL2-01        tgtggatgaccgagtacctgaaccggcatctgcacacctggatccaggat
                        ****** **   ********    ** **  *  * *********** 

B2Z3Z4_BCL2L1-01      aacggcggctgggacactttcgtggaactctacggaaacaatgcagcagc
Q9JJV8_BCL2-01        aacggaggctgggacgcatttgtggaactgtacggccccagtg-------
                      ***** ********* * ** ******** *****   ** **       

B2Z3Z4_BCL2L1-01      tgagagccggaaaggccaggagcgcttcaaccgctggttcctgacgggca
Q9JJV8_BCL2-01        tgaggcc--------tctgtttgatttctcttggctgtctctgaagaccc
                      ****  *         * *      ***    *   **  **** *  * 

B2Z3Z4_BCL2L1-01      t-----gactgtggctggtgtggttctg-------ctgggctctctcttc
Q9JJV8_BCL2-01        tgctcagcctggccctggtcggggcctgcatcactctgggtacctacctg
                      *     * ***   *****  **  ***       *****  *   * * 

B2Z3Z4_BCL2L1-01      agtcggaagtga
Q9JJV8_BCL2-01        ggccacaagtga
                       * *  ******

© 1998-2018