Dataset for CDS BCL2L1 of organism Cricetulus griseus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3HEA7_BCL2L1-02      atgtctcagagcaaccgggagctagtggttgactttctctcctacaagct
G3HEA7_BCL2L1-01      atgtctcagagcaaccgggagctagtggttgactttctctcctacaagct
B2Z3Z4_BCL2L1-01      atgtctcagagcaaccgggagctagtggttgactttctctcctacaagtt
                      ************************************************ *

G3HEA7_BCL2L1-02      ctcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaaca
G3HEA7_BCL2L1-01      ctcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaaca
B2Z3Z4_BCL2L1-01      ctcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaaca
                      **************************************************

G3HEA7_BCL2L1-02      ggactgaggccccagaaggaactgaatcagagagggagacccccagtgcc
G3HEA7_BCL2L1-01      ggactgaggccccagaaggaactgaatcagagagggagacccccagtgcc
B2Z3Z4_BCL2L1-01      ggactgaggccccagaaggaactgaatcagagagggagacccccagtgcc
                      **************************************************

G3HEA7_BCL2L1-02      atcaatggcaacccatcctggcacctggcggacagccccgcggtaaatgg
G3HEA7_BCL2L1-01      atcaatggcaacccatcctggcacctggcggacagccccgcggtaaatgg
B2Z3Z4_BCL2L1-01      atcaatggcaacccatcctggcacctggcggacagccccgcggtaaatgg
                      **************************************************

G3HEA7_BCL2L1-02      agccactggccacagcagcagtttggatgcacgggaggtgatccccatgg
G3HEA7_BCL2L1-01      agccactggccacagcagcagtttggatgcacgggaggtgatccccatgg
B2Z3Z4_BCL2L1-01      agccactggccacagcagcagtttggatgcacgggaggtgatccccatgg
                      **************************************************

G3HEA7_BCL2L1-02      cagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcgg
G3HEA7_BCL2L1-01      cagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcgg
B2Z3Z4_BCL2L1-01      cagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcgg
                      **************************************************

G3HEA7_BCL2L1-02      taccggcgggcgttcagtgatctaacatcccagcttcatataaccccagg
G3HEA7_BCL2L1-01      taccggcgggcgttcagtgatctaacatcccagcttcatataaccccagg
B2Z3Z4_BCL2L1-01      taccggcgggcgttcagtgatctaacatcccagcttcatataaccccagg
                      **************************************************

G3HEA7_BCL2L1-02      gactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
G3HEA7_BCL2L1-01      gactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
B2Z3Z4_BCL2L1-01      gactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
                      **************************************************

G3HEA7_BCL2L1-02      gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctc
G3HEA7_BCL2L1-01      gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctc
B2Z3Z4_BCL2L1-01      gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctc
                      **************************************************

G3HEA7_BCL2L1-02      tgtgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
G3HEA7_BCL2L1-01      tgtgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
B2Z3Z4_BCL2L1-01      tgtgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                      **************************************************

G3HEA7_BCL2L1-02      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
G3HEA7_BCL2L1-01      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
B2Z3Z4_BCL2L1-01      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
                      **************************************************

G3HEA7_BCL2L1-02      acaacggcggctgggacactttcgtggaactctacggaaacaatgcagca
G3HEA7_BCL2L1-01      acaacggcggctgggacactttcgtggaactctacggaaacaatgcagca
B2Z3Z4_BCL2L1-01      acaacggcggctgggacactttcgtggaactctacggaaacaatgcagca
                      **************************************************

G3HEA7_BCL2L1-02      gctgagagccggaaaggccaggagcgcttcaaccgctggttcctgacggg
G3HEA7_BCL2L1-01      gctgagagccggaaaggccaggagcgcttcaaccgctggttcctgacggg
B2Z3Z4_BCL2L1-01      gctgagagccggaaaggccaggagcgcttcaaccgctggttcctgacggg
                      **************************************************

G3HEA7_BCL2L1-02      catgactgtggctggtgtggttctgctgggctctctcttcagtcggaagt
G3HEA7_BCL2L1-01      catgactgtggctggtgtggttctgctgggctctctcttcagtcggaagt
B2Z3Z4_BCL2L1-01      catgactgtggctggtgtggttctgctgggctctctcttcagtcggaagt
                      **************************************************

G3HEA7_BCL2L1-02      ga
G3HEA7_BCL2L1-01      ga
B2Z3Z4_BCL2L1-01      ga
                      **

© 1998-2019