Dataset for CDS MCL-1 of organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5I9Q7_MCL1-02      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K5I9Q7_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K5I9Q7_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
                        **************************************************

A0A2K5I9Q7_MCL1-02      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K5I9Q7_MCL1-01      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K5I9Q7_MCL1-03      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
                        **************************************************

A0A2K5I9Q7_MCL1-02      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K5I9Q7_MCL1-01      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K5I9Q7_MCL1-03      ggctttt-------------------------------------------
                        *******                                           

A0A2K5I9Q7_MCL1-02      ggggaggccggcacggtgattggcggaagcgccggcgcaagccccccggc
A0A2K5I9Q7_MCL1-01      ggggaggccggcacggtgattggcggaagcgccggcgcaagccccccggc
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5I9Q7_MCL1-02      cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
A0A2K5I9Q7_MCL1-01      cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5I9Q7_MCL1-02      ccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcg
A0A2K5I9Q7_MCL1-01      ccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcg
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5I9Q7_MCL1-02      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
A0A2K5I9Q7_MCL1-01      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5I9Q7_MCL1-02      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A2K5I9Q7_MCL1-01      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5I9Q7_MCL1-02      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A2K5I9Q7_MCL1-01      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5I9Q7_MCL1-02      aatagctccagtacggatgggtcactaccctcgacgccgccgccagcaga
A0A2K5I9Q7_MCL1-01      aatagctccagtacggatgggtcactaccctcgacgccgccgccagcaga
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5I9Q7_MCL1-02      ggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcggt
A0A2K5I9Q7_MCL1-01      ggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcggt
A0A2K5I9Q7_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5I9Q7_MCL1-02      accttcgggagcaggccactggcgccaaggacacacagccaatgggcagg
A0A2K5I9Q7_MCL1-01      accttcgggagcaggccactggcgccaaggacacacagccaatgggcagg
A0A2K5I9Q7_MCL1-03      -------------ggccactggcgccaaggacacacagccaatgggcagg
                                     *************************************

A0A2K5I9Q7_MCL1-02      tctggggccaccagcaggaaggctctggagaccttacgacgggtggggga
A0A2K5I9Q7_MCL1-01      tctggggccaccagcaggaaggctctggagaccttacgacgggtggggga
A0A2K5I9Q7_MCL1-03      tctggggccaccagcaggaaggctctggagaccttacgacgggtggggga
                        **************************************************

A0A2K5I9Q7_MCL1-02      tggcgtgcagcgcaaccacgagacggccttccaa----------------
A0A2K5I9Q7_MCL1-01      tggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaac
A0A2K5I9Q7_MCL1-03      tggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaac
                        **********************************                

A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      tggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatgatc
A0A2K5I9Q7_MCL1-03      tggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatgatc
                                                                          

A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      catgttttcagcgacggcgtaacaaactggggcaggattgtgactctcat
A0A2K5I9Q7_MCL1-03      catgttttcagcgacggcgtaacaaactggggcaggattgtgactctcat
                                                                          

A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
A0A2K5I9Q7_MCL1-03      ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
                                                                          

A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      gttgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggaca
A0A2K5I9Q7_MCL1-03      gttgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggaca
                                                                          

A0A2K5I9Q7_MCL1-02      --------------------------------ggatgggtttgtggagtt
A0A2K5I9Q7_MCL1-01      aaacgggactggctagttaaacaaagaggctgggatgggtttgtggagtt
A0A2K5I9Q7_MCL1-03      aaacgggactggctagttaaacaaagaggctgggatgggtttgtggagtt
                                                        ******************

A0A2K5I9Q7_MCL1-02      cttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggctt
A0A2K5I9Q7_MCL1-01      cttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggctt
A0A2K5I9Q7_MCL1-03      cttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggctt
                        **************************************************

A0A2K5I9Q7_MCL1-02      ttgcaggtgttgctggagtaggagctggtttggcatatctaatcagatag
A0A2K5I9Q7_MCL1-01      ttgcaggtgttgctggagtaggagctggtttggcatatctaatcagatag
A0A2K5I9Q7_MCL1-03      ttgcaggtgttgctggagtaggagctggtttggcatatctaatcagatag
                        **************************************************

A0A2K5I9Q7_MCL1-02      ccttactgtaa
A0A2K5I9Q7_MCL1-01      -----------
A0A2K5I9Q7_MCL1-03      -----------
                                   

© 1998-2018