Dataset for CDS BCL-2-like of organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5KAB6_BCL2A1-      atgacagac-----------------tgtgaatttggatatatttacag-
A0A2K5KAB6_BCL2A1-      atgacagac-----------------tgtgaatttggatatatttacag-
A0A2K5H963_BCL2L1-      ------------------atgtctcagagcaaccgggagctagtggttga
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      atggcgacc---ccagcctcggccccagacacacgggctctggtggcaga
A0A2K5HEK7_BCL2L2-      atggcgacc---ccagcctcggccccagacacacgggctctggtggcaga
A0A2K5HK49_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K5K3B0_BCL2L10      atggctgac-----------------cagttgcgggagcgcaccaacgtg
A0A2K5I9Q7_MCL1-02      atgtttggc-----------------c-tcaaaagaaacgcggtaatcgg
A0A2K5I9Q7_MCL1-01      atgtttggc-----------------c-tcaaaagaaacgcggtaatcgg
A0A2K5I9Q7_MCL1-03      atgtttggc-----------------c-tcaaaagaaacgcggtaatcgg

A0A2K5KAB6_BCL2A1-      ---------------gctagctcaggactattt-----------------
A0A2K5KAB6_BCL2A1-      ---------------gctagctcaggactattt-----------------
A0A2K5H963_BCL2L1-      ctttctctcctacaagctttcccagaaaggata--cagctggagtcagtt
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      ctttgtaggttataagctgaggcagaagggtta--tgtc-----------
A0A2K5HEK7_BCL2L2-      ctttgtaggttataagctgaggcagaagggtta--tgtc-----------
A0A2K5HK49_BCL2-01      gtacatccactataagctgtcgcagaggggcta--cgagtggga------
A0A2K5K3B0_BCL2L10      gctgaccc-------gttgc-gcgagcgcaccgagcggctgctg------
A0A2K5I9Q7_MCL1-02      actcaacc-------tctactgtgggggggccg---gcttgggg------
A0A2K5I9Q7_MCL1-01      actcaacc-------tctactgtgggggggccg---gcttgggg------
A0A2K5I9Q7_MCL1-03      actcaacc-------tctactgtgggggggccg---gcttgggg------

A0A2K5KAB6_BCL2A1-      ----------------------gcagtacgtcctgcagat----------
A0A2K5KAB6_BCL2A1-      ----------------------gcagtacgtcctgcagat----------
A0A2K5H963_BCL2L1-      tagtgatgtggaagagaacaggactgaggccccagaaggg----------
A0A2K5H963_BCL2L1-      -----atgtggaagagaacaggactgaggccccagaaggg----------
A0A2K5HEK7_BCL2L2-      ------tgtgga----------gct--ggccccggggagg----------
A0A2K5HEK7_BCL2L2-      ------tgtgga----------gct--ggccccggggagg----------
A0A2K5HK49_BCL2-01      ------tgcgggggatgtgggagccgcgacccctggggcc----------
A0A2K5K3B0_BCL2L10      ------gccgactatctggggtgctgcgc--ccgggaacccggc------
A0A2K5I9Q7_MCL1-02      ------gccggc-agcggcggcgccacccctccgggagggcggcttttgg
A0A2K5I9Q7_MCL1-01      ------gccggc-agcggcggcgccacccctccgggagggcggcttttgg
A0A2K5I9Q7_MCL1-03      ------gccggc-agcggcggcgccacccctccgggagggcggctttt--
                                               *       ** *               

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9Q7_MCL1-02      ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
A0A2K5I9Q7_MCL1-01      ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      ----------------------------------actgaat---------
A0A2K5H963_BCL2L1-      ----------------------------------actgaat---------
A0A2K5HEK7_BCL2L2-      ----------------------------------gccca-----------
A0A2K5HEK7_BCL2L2-      ----------------------------------gccca-----------
A0A2K5HK49_BCL2-01      -------------------------------gcccccgcac---------
A0A2K5K3B0_BCL2L10      -------------------------------acccccgagc---------
A0A2K5I9Q7_MCL1-02      ggcacggtgattggcggaagcgccggcgcaagccccccggccgccctcac
A0A2K5I9Q7_MCL1-01      ggcacggtgattggcggaagcgccggcgcaagccccccggccgccctcac
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      ----------------------------accacaacctggatcgggtcca
A0A2K5KAB6_BCL2A1-      ----------------------------accacaacctggatcgggtcca
A0A2K5H963_BCL2L1-      --------------------cggagatggagacccccagtgcca------
A0A2K5H963_BCL2L1-      --------------------cggagatggagacccccagtgcca------
A0A2K5HEK7_BCL2L2-      ---------------------gcagct---gacccgctgcac--------
A0A2K5HEK7_BCL2L2-      ---------------------gcagct---gacccgctgcac--------
A0A2K5HK49_BCL2-01      --------------------cgggcatcttctcctcccagcccgggcaca
A0A2K5K3B0_BCL2L10      --------------------cgaggccgtccacgcccgaggccg---ccg
A0A2K5I9Q7_MCL1-02      gccagacgcccggagggtcgcgcggccgccgcccattggcgccg---agg
A0A2K5I9Q7_MCL1-01      gccagacgcccggagggtcgcgcggccgccgcccattggcgccg---agg
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      ag--------caaaacgtccagagtgctacaaaa----------------
A0A2K5KAB6_BCL2A1-      ag--------caaaacgtccagagtgctacaaaa----------------
A0A2K5H963_BCL2L1-      ---tcaatggcaacccatcctggcacctggtggacagccccgcggtgaat
A0A2K5H963_BCL2L1-      ---tcaatggcaacccatcct-----------------------------
A0A2K5HEK7_BCL2L2-      ----------caagccatgcgggca-------------------------
A0A2K5HEK7_BCL2L2-      ----------caagccatgcgggca-------------------------
A0A2K5HK49_BCL2-01      cgccccatcccgccgcgtcccgggacccgg---------------tcgcc
A0A2K5K3B0_BCL2L10      tgctgcgctccgcggcggcccgattacggcagct-----------ccatc
A0A2K5I9Q7_MCL1-02      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
A0A2K5I9Q7_MCL1-01      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      -----------------------------------ggttgcattctcagt
A0A2K5KAB6_BCL2A1-      -----------------------------------ggttgcattctcagt
A0A2K5H963_BCL2L1-      ggagccactggccacagcagcagtttggatgcccgggaggtgatccccat
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HK49_BCL2-01      aggacctcgccgctgccg------------accccggctgcccccgccgc
A0A2K5K3B0_BCL2L10      ggtccttcttctccgcct------------acctcggctaccccgggaac
A0A2K5I9Q7_MCL1-02      cgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccat
A0A2K5I9Q7_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccat
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      ccaggaaga-------------------agtggaaaagaatctga-----
A0A2K5KAB6_BCL2A1-      ccaggaaga-------------------agtggaaaagaatctga-----
A0A2K5H963_BCL2L1-      ggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaa----
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      ----------------------------gctggagatgagttcgag----
A0A2K5HEK7_BCL2L2-      ----------------------------gctggagatgagttcgag----
A0A2K5HK49_BCL2-01      cgccgc------------------------------ggggcctg------
A0A2K5K3B0_BCL2L10      cgcgtc-------------------------------gagctgg------
A0A2K5I9Q7_MCL1-02      catgtcg---------------------cccgaagaggagctggacgggt
A0A2K5I9Q7_MCL1-01      catgtcg---------------------cccgaagaggagctggacgggt
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      ------------------------------------agccgtgcttggac
A0A2K5KAB6_BCL2A1-      ------------------------------------agccgtgcttggac
A0A2K5H963_BCL2L1-      ------------------------------------ctgcggtaccggcg
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      ------------------------------------acccgcttccggcg
A0A2K5HEK7_BCL2L2-      ------------------------------------acccgcttccggcg
A0A2K5HK49_BCL2-01      --------------------------cgcttagcccagtgccacctgtgg
A0A2K5K3B0_BCL2L10      ------------------------------------tggcgctgatggcg
A0A2K5I9Q7_MCL1-02      acgagccggagcctctcgggaagcggccggctgtcctgcccctgctggag
A0A2K5I9Q7_MCL1-01      acgagccggagcctctcgggaagcggccggctgtcctgcccctgctggag
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      aatgttaatgt---------------------------------------
A0A2K5KAB6_BCL2A1-      aatgttaatgt---------------------------------------
A0A2K5H963_BCL2L1-      ggcgttcagtgacctgacatcccagc------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      caccttctctgatctggcggctcagc------------------------
A0A2K5HEK7_BCL2L2-      caccttctctgatctggcggctcagc------------------------
A0A2K5HK49_BCL2-01      tccaccttaccctccgccaggccggt--------gacgacttctcccgcc
A0A2K5K3B0_BCL2L10      gaggccgtgctctccgacagccccgg------------------------
A0A2K5I9Q7_MCL1-02      ttggtcggggaatctaatagctccagtacggatgggtcactaccctcgac
A0A2K5I9Q7_MCL1-01      ttggtcggggaatctaatagctccagtacggatgggtcactaccctcgac
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HK49_BCL2-01      gctaccgccgc--------gacttcgccgagatgtccagccagc------
A0A2K5K3B0_BCL2L10      -----ccccacctggggcagggtgg-------------------------
A0A2K5I9Q7_MCL1-02      gccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctgg
A0A2K5I9Q7_MCL1-01      gccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctgg
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      ----tgcatccatagacactgccagaacaata----ttcaatcaagtgat
A0A2K5KAB6_BCL2A1-      ----tgcatccatagacactgccagaacaata----ttcaatcaagtgat
A0A2K5H963_BCL2L1-      ----tccacatcaccccagggacagcatatcagagctttgaacaggtagt
A0A2K5H963_BCL2L1-      ------------------gggacagcatatcagagctttgaacaggtagt
A0A2K5HEK7_BCL2L2-      ----tgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtctc
A0A2K5HEK7_BCL2L2-      ----tgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtctc
A0A2K5HK49_BCL2-01      ----tgcacctgacgcccttcaccgcgcggggacgctttgccacggtggt
A0A2K5K3B0_BCL2L10      ----tgtcgctggtgacctt-----cgcggggacgctgc----tggagag
A0A2K5I9Q7_MCL1-02      aaattatctctcggtacctt-----cgggagcaggccac----tggcgcc
A0A2K5I9Q7_MCL1-01      aaattatctctcggtacctt-----cgggagcaggccac----tggcgcc
A0A2K5I9Q7_MCL1-03      ---------------------------------ggccac----tggcgcc

A0A2K5KAB6_BCL2A1-      ggaaaaggagtttgaagatggcatcattaactggggaagaattgtaacca
A0A2K5KAB6_BCL2A1-      ggaaaaggagtttgaagatggcatcattaactggggaagaattgtaacca
A0A2K5H963_BCL2L1-      gaatgaactcttccgggatggggta---aactggggtcgcattgtggcct
A0A2K5H963_BCL2L1-      gaatgaactcttccgggatggggta---aactggggtcgcattgtggcct
A0A2K5HEK7_BCL2L2-      tgatgaacttttccaagggggcccc---aactggggccgccttgtagcct
A0A2K5HEK7_BCL2L2-      tgatgaacttttccaagggggcccc---aactggggccgccttgtagcct
A0A2K5HK49_BCL2-01      ggaggagctcttcagggacggggtg---aactgggggaggattgtggcct
A0A2K5K3B0_BCL2L10      agagccgctggtgacagcctg-----------gtggaagaagcggagctt
A0A2K5I9Q7_MCL1-02      aaggacac-----acagccaa-----------tgggcaggtctggggcca
A0A2K5I9Q7_MCL1-01      aaggacac-----acagccaa-----------tgggcaggtctggggcca
A0A2K5I9Q7_MCL1-03      aaggacac-----acagccaa-----------tgggcaggtctggggcca
                                        *                 **  *    *   *  

A0A2K5KAB6_BCL2A1-      tatttgcatttgaaggtattct---catcaagaaacttctacgacagcga
A0A2K5KAB6_BCL2A1-      tatttgcatttgaaggtattct---catcaagaaacttctacgacagcga
A0A2K5H963_BCL2L1-      ttttctccttcggcggggcactgtgcgtggaaa----gcgtagacaagga
A0A2K5H963_BCL2L1-      ttttctccttcggcggggcactgtgcgtggaaa----gcgtagacaagga
A0A2K5HEK7_BCL2L2-      tctttgtctttggggctgcactgtgtgctgaga----gtgtcaacaagga
A0A2K5HEK7_BCL2L2-      tctttgtctttggggctgcactgtgtgctgaga----gtgtcaacaagga
A0A2K5HK49_BCL2-01      tctttgagttcggtggggtcatgtgtgtggaga----gcgtcaaccggga
A0A2K5K3B0_BCL2L10      cc-----agccgcgg----c-------tgaagg------agcaggagggc
A0A2K5I9Q7_MCL1-02      cc-----agcaggaaggctc-------tggagaccttacgacgggtgggg
A0A2K5I9Q7_MCL1-01      cc-----agcaggaaggctc-------tggagaccttacgacgggtgggg
A0A2K5I9Q7_MCL1-03      cc-----agcaggaaggctc-------tggagaccttacgacgggtgggg
                                   *                  *                 * 

A0A2K5KAB6_BCL2A1-      attgccccggatgtggatacttataaggagatttcgtat-----------
A0A2K5KAB6_BCL2A1-      attgccccggatgtggatacttataaggagatttcgtat-----------
A0A2K5H963_BCL2L1-      gatgcaggtattggtga-----gtcggatcgcaacttgg-----------
A0A2K5H963_BCL2L1-      gatgcaggtattggtga-----gtcggatcgcaacttgg-----------
A0A2K5HEK7_BCL2L2-      gatggaaccactggtgg-----gacaagtgcaggagtgg-----------
A0A2K5HEK7_BCL2L2-      gatggaaccactggtgg-----gacaagtgcaggagtgg-----------
A0A2K5HK49_BCL2-01      gatgtcgcccctggtggacaacatc-----gccctgtgg-----------
A0A2K5K3B0_BCL2L10      gacgtcgcccgggactgccagcgcctggtggccttgctgagctcgc----
A0A2K5I9Q7_MCL1-02      gatggcgtgcag---cgcaaccacgagacggccttccaa-----------
A0A2K5I9Q7_MCL1-01      gatggcgtgcag---cgcaaccacgagacggccttccaaggcatgcttcg
A0A2K5I9Q7_MCL1-03      gatggcgtgcag---cgcaaccacgagacggccttccaaggcatgcttcg

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      gaaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtga
A0A2K5I9Q7_MCL1-03      gaaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtga

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      tgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgact
A0A2K5I9Q7_MCL1-03      tgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgact

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca
A0A2K5I9Q7_MCL1-03      ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca

A0A2K5KAB6_BCL2A1-      ----------------------------tttgttgctgagttcataatga
A0A2K5KAB6_BCL2A1-      ----------------------------tttgttgctgagttcataatga
A0A2K5H963_BCL2L1-      -------------------------------atggccacttatctgaatg
A0A2K5H963_BCL2L1-      -------------------------------atggccacttatctgaatg
A0A2K5HEK7_BCL2L2-      -------------------------------atggtggcctacctggaga
A0A2K5HEK7_BCL2L2-      -------------------------------atggtggcctacctggaga
A0A2K5HK49_BCL2-01      -------------------------------atgactgagtacctgaacc
A0A2K5K3B0_BCL2L10      -----------------------------------------ggctcgcgg
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      agaaagttgcatcgaaccattagcagaaagtatcacagacgttctcgtaa
A0A2K5I9Q7_MCL1-03      agaaagttgcatcgaaccattagcagaaagtatcacagacgttctcgtaa

A0A2K5KAB6_BCL2A1-      ataacacaggagaatggataaggcaaaacggaggct-ggga---------
A0A2K5KAB6_BCL2A1-      ataacacaggagaatggataaggcaaaacggaggctggggg---------
A0A2K5H963_BCL2L1-      accacctagagccttggatccaggagaacggcggctgggac------act
A0A2K5H963_BCL2L1-      accacctagagccttggatccaggagaacggcggctgggac------act
A0A2K5HEK7_BCL2L2-      cgcggctggctgactggatccacagcagtgggggctgggcg------gag
A0A2K5HEK7_BCL2L2-      cgcggctggctgactggatccacagcagtgggggctgggagctggaagct
A0A2K5HK49_BCL2-01      ggcacctgcacacctggatccaggataacggaggctgggat------gcc
A0A2K5K3B0_BCL2L10      ggcagcaccgcgcctggcttcaggctcagggcggttgggat------ggc
A0A2K5I9Q7_MCL1-02      -------------------------------------ggat------ggg
A0A2K5I9Q7_MCL1-01      ggacaaaacgggactggctagttaaacaaagaggctgggat------ggg
A0A2K5I9Q7_MCL1-03      ggacaaaacgggactggctagttaaacaaagaggctgggat------ggg

A0A2K5KAB6_BCL2A1-      -----------------------------------aaatggctttgtaaa
A0A2K5KAB6_BCL2A1-      -----------------------------------aaatggc-------a
A0A2K5H963_BCL2L1-      tttgtggaactctatgggaacaatgc------agcagctgagagccgaaa
A0A2K5H963_BCL2L1-      tttgtggaactctatgggaacaatgc------agcagctgagagccgaaa
A0A2K5HEK7_BCL2L2-      ttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcg
A0A2K5HEK7_BCL2L2-      atcaaagctcgagtcagggagatgga---ggaagaagctgagaagctaaa
A0A2K5HK49_BCL2-01      tttgtggaactgtac--------ggc---cccagcatgtggcctctgttt
A0A2K5K3B0_BCL2L10      ttctgtcacttcttc-------aggaccccctttccgctggctttttgga
A0A2K5I9Q7_MCL1-02      tttgtggagttcttccatgtagagga---cctagaaggtggcatc----a
A0A2K5I9Q7_MCL1-01      tttgtggagttcttccatgtagagga---cctagaaggtggcatc----a
A0A2K5I9Q7_MCL1-03      tttgtggagttcttccatgtagagga---cctagaaggtggcatc----a

A0A2K5KAB6_BCL2A1-      gaagt--------------ttgaacctaaatctggctggatgacttttct
A0A2K5KAB6_BCL2A1-      caatc--------------acatgcctatg-ctagtagagtcagtggccc
A0A2K5H963_BCL2L1-      gggcc--------------aggagcgcttcaaccgctgg-----ttcctg
A0A2K5H963_BCL2L1-      gggcc--------------aggagcgcttcaaccgctgg-----ttcctg
A0A2K5HEK7_BCL2L2-      ggag---------------gggaactgggcatcagtgag----------g
A0A2K5HEK7_BCL2L2-      ggagctacagaacgaggtagagaagcagatgaatatgagtccacctccag
A0A2K5HK49_BCL2-01      gat---------------------------ttctcctg--gctgtctctg
A0A2K5K3B0_BCL2L10      gaa---------------------------aactgctgatccaggctttc
A0A2K5I9Q7_MCL1-02      gaa---------------------------atgtgctg--ctggcttttg
A0A2K5I9Q7_MCL1-01      gaa---------------------------atgtgctg--ctggcttttg
A0A2K5I9Q7_MCL1-03      gaa---------------------------atgtgctg--ctggcttttg

A0A2K5KAB6_BCL2A1-      aga----------------------------------------------a
A0A2K5KAB6_BCL2A1-      aca----------------------------------------------a
A0A2K5H963_BCL2L1-      acg---------ggcatgac-----------------------------t
A0A2K5H963_BCL2L1-      acg---------ggcatgac-----------------------------t
A0A2K5HEK7_BCL2L2-      aca---------gtgctgac-----------------------------g
A0A2K5HEK7_BCL2L2-      gca---------atgctggcccagtgatcatgtccattgaggagaagatg
A0A2K5HK49_BCL2-01      aagactctgctcagtttggc-----------------------------c
A0A2K5K3B0_BCL2L10      ctg----------gcatgct-----------------------------t
A0A2K5I9Q7_MCL1-02      cag----------gtgttgc-----------------------------t
A0A2K5I9Q7_MCL1-01      cag----------gtgttgc-----------------------------t
A0A2K5I9Q7_MCL1-03      cag----------gtgttgc-----------------------------t

A0A2K5KAB6_BCL2A1-      gttacaggaaagatctgtgaaatgc-tatctctcctgaagcaatactgt-
A0A2K5KAB6_BCL2A1-      gaagaagaaaatggctttgtaa----------------------------
A0A2K5H963_BCL2L1-      gtggccggcg----------------tggttctgctgggctcact-----
A0A2K5H963_BCL2L1-      gtggccggcg----------------tggttctgctgggctcact-----
A0A2K5HEK7_BCL2L2-      ggggccg-------------------tggcactgggggccctggt-----
A0A2K5HEK7_BCL2L2-      gaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaac
A0A2K5HK49_BCL2-01      ctggtgggagcttgcatcaccctgggtgcctatctgggccaca----ag-
A0A2K5K3B0_BCL2L10      g--ttaacaacagccttc-----ggttatct--ctggacacgattatta-
A0A2K5I9Q7_MCL1-02      ggagtaggagctggtttg-----gcatatctaatcagatagccttactg-
A0A2K5I9Q7_MCL1-01      ggagtaggagctggtttg-----gcatatctaatcagatag---------
A0A2K5I9Q7_MCL1-03      ggagtaggagctggtttg-----gcatatctaatcagatag---------

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      agcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtg
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      -----------------aactgtaggggcctt------------------
A0A2K5HEK7_BCL2L2-      ttaccatactctgtgacaaatttagtggccatcccaaagggtttgcgtat
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      atagagttctcagacaaagagtcagtgaggacgtccttggccttagatga
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      gtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaaca
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      --------------------------------------------------
A0A2K5HEK7_BCL2L2-      gaccaggcatcagcacaacagaccggggttttccacgagcccgctaccgc
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      -----------------------------------------------ctt
A0A2K5H963_BCL2L1-      -----------------------------------------------ctt
A0A2K5HEK7_BCL2L2-      -----------------------------------------------ttt
A0A2K5HEK7_BCL2L2-      gcccggaccaccaactacaacagttcccgctctcgattctacagtggttt
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5KAB6_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      cagtcggaaa----------------------------------------
A0A2K5H963_BCL2L1-      cagtcggaaa----------------------------------------
A0A2K5HEK7_BCL2L2-      tgctagcaag----------------------------------------
A0A2K5HEK7_BCL2L2-      taacagcaggccccggggtcgcgtctacaggggccgggctagagcgacat
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9Q7_MCL1-02      --------------------------------------------------
A0A2K5I9Q7_MCL1-01      --------------------------------------------------
A0A2K5I9Q7_MCL1-03      --------------------------------------------------

A0A2K5KAB6_BCL2A1-      -----------------tga
A0A2K5KAB6_BCL2A1-      --------------------
A0A2K5H963_BCL2L1-      -----------------tga
A0A2K5H963_BCL2L1-      -----------------tga
A0A2K5HEK7_BCL2L2-      -----------------tga
A0A2K5HEK7_BCL2L2-      catggtattccccttactaa
A0A2K5HK49_BCL2-01      -----------------tga
A0A2K5K3B0_BCL2L10      -----------------tga
A0A2K5I9Q7_MCL1-02      -----------------taa
A0A2K5I9Q7_MCL1-01      --------------------
A0A2K5I9Q7_MCL1-03      --------------------

© 1998-2019