Dataset for CDS BCL-2-like of organism Chlorocebus sabaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A0D9RRC3_BCL2A1-      atgacagactgtgaatttggatatatttacaggctagctcaggactattt
A0A0D9RJZ8_BCL2L1-      atgtctca----------------------------------gagcaacc
A0A0D9S017_BCL2-01      atggcgcacgctgggagaa----------------cagggtacgataacc
A0A0D9RU30_BCL2L2-      atggc-gaccc------------------cagcctcggccccagacacac
A0A0D9RG38_BCL2L10      atggctgaccc---------------------------------------
A0A0D9RZP5_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg

A0A0D9RRC3_BCL2A1-      gcagtac-------------gtcctgcagataccacaacctg----gatc
A0A0D9RJZ8_BCL2L1-      gggag------------------ctggtggtt-gactt--------tctc
A0A0D9S017_BCL2-01      gggag---------------atagtgatgaag-tac-----------atc
A0A0D9RU30_BCL2L2-      gg------------------gctctggtggca-gactt--------tgta
A0A0D9RG38_BCL2L10      --------------------gttgcgggagcg-cacc---------gagc
A0A0D9RZP5_MCL1-01      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
                                                 *        **              

A0A0D9RRC3_BCL2A1-      gggtccaagcaaaacgtccagagtgctaca--------------------
A0A0D9RJZ8_BCL2L1-      tcctacaagctttc--ccagaaaggatacagctggagtcaatttagtgat
A0A0D9S017_BCL2-01      cactataagctgtc--gcagaggggctacgagt-----------------
A0A0D9RU30_BCL2L2-      ggttataagctgag--gcagaagggttatgtct-----------------
A0A0D9RG38_BCL2L10      ggctcctggccgactatctggggtgctgcgccc-----------------
A0A0D9RZP5_MCL1-01      ggcttttggctacggagaaggaggcctcggctcggcgagagataggggga
                           *    **                *                       

A0A0D9RRC3_BCL2A1-      ---aaag---gttgcatcctcagtccaaaaagaagtggaaaagaat----
A0A0D9RJZ8_BCL2L1-      gtggaagagaacaggactgaggccccagaagggactgaatcggaga----
A0A0D9S017_BCL2-01      -gggatg---cgggggatgtgggcgccgcgacccctggggccgcccccgc
A0A0D9RU30_BCL2L2-      -gtggag---ctggccccggggagggcccagcagctgacccgctgc----
A0A0D9RG38_BCL2L10      -gggaac---ccggcac---------------ccctga-------g----
A0A0D9RZP5_MCL1-01      ggggagg---ccggcacggtgattggcggaagcgctggcgcaagcc----
                                     *                     **             

A0A0D9RRC3_BCL2A1-      -----------------ctgaagccatgcttgga----------------
A0A0D9RJZ8_BCL2L1-      -----------------tggagacccccagtgccatcaatggcaacccat
A0A0D9S017_BCL2-01      accgggcatcttctcctcccagcccgggcacacgccccatcccgccgcgt
A0A0D9RU30_BCL2L2-      -----------------accaagccatgcgggca----------------
A0A0D9RG38_BCL2L10      -----------------cccaggccgtc--cacg----------------
A0A0D9RZP5_MCL1-01      -----------------ccccggccgccctcacg----------------

A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      cctggcacctggtggacagccccgcggtgaatggagccactggccacagc
A0A0D9S017_BCL2-01      cccgggacccggtcgccaggacctcgccgctgccgacc------------
A0A0D9RU30_BCL2L2-      gctggagatgagt---tcgagacccgcttccggcgcaccttctctgatct
A0A0D9RG38_BCL2L10      cccgaggcc-----------gccgtgctg----cgctc-----c------
A0A0D9RZP5_MCL1-01      ccagacgcccgg-----agggtcgcgcggccgccgcccattggc------

A0A0D9RRC3_BCL2A1-      --------caatgttaatgttgcatccatagacactgcca----------
A0A0D9RJZ8_BCL2L1-      agcagtttggatgcccgggaggtgatccccatggcagcag----------
A0A0D9S017_BCL2-01      -cc-----ggctgcccccgccgccgccgcggggcctgcgctcagcccggt
A0A0D9RU30_BCL2L2-      ggc-----ggctcagctgcatgtgaccccaggctcagcgc----------
A0A0D9RG38_BCL2L10      -gc-----gg----ccgccaggttacggcagctccaccgg----------
A0A0D9RZP5_MCL1-01      -gc-----ggaggtccccgacgtcaccgcgacccccgcga----------
                                             *            *  *            

A0A0D9RRC3_BCL2A1-      -------------------------------------gaacactattc--
A0A0D9RJZ8_BCL2L1-      -----------taaagcaaacgctgagggaggcaggcgacgagtttgaac
A0A0D9S017_BCL2-01      gccacctgtggtccacctgaccctccgccaggccggtgacgacttctccc
A0A0D9RU30_BCL2L2-      -------------------------------------agcaacgcttc--
A0A0D9RG38_BCL2L10      -------------------------------------tccttcttctc--
A0A0D9RZP5_MCL1-01      -------------------------------------ggctgcttttctt

A0A0D9RRC3_BCL2A1-      --------------------------------aatcaagtg---------
A0A0D9RJZ8_BCL2L1-      tgcggtaccggcgggcgttcagtgacctgacatcccagctccacatcacc
A0A0D9S017_BCL2-01      gccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacg
A0A0D9RU30_BCL2L2-      ---------acccaggtctc-cgatgaacttttccaa---g-----gggg
A0A0D9RG38_BCL2L10      --cgc--ctacctcggctaccccgggaaccgcgtcgagctg-----gtgg
A0A0D9RZP5_MCL1-01      tgcgc--ccaccc--gccgcgcggcgccgcttgaggagatg-----gaag

A0A0D9RRC3_BCL2A1-      -------------------------------atggaaaaggagtttgaag
A0A0D9RJZ8_BCL2L1-      ccagggacagcatatcagagcttt-gaacaggtagtgaatgaactcttcc
A0A0D9S017_BCL2-01      cccttcaccgcgcggggacgcttt-gccacggtggtggaggagctcttca
A0A0D9RU30_BCL2L2-      cc-----ccaactggggccgcctt--------------------------
A0A0D9RG38_BCL2L10      cg-----ctgatggcggacgccgt--------------------------
A0A0D9RZP5_MCL1-01      cc-----ccggccgccgacgccatcatgtcgcccgaagaggagctggacg

A0A0D9RRC3_BCL2A1-      atggcatcattaa----ctggggaaga--------attgtaaccatattt
A0A0D9RJZ8_BCL2L1-      gggatggggtaaa----ctggggtcgc--------attgtggcctttttc
A0A0D9S017_BCL2-01      gggacggggtgaa----ctgggggagg--------atcgtggccttcttt
A0A0D9RU30_BCL2L2-      ----------------------gtagc------cttctttgtct---ttg
A0A0D9RG38_BCL2L10      --------------gctctccgacagc---------cccggccccacctg
A0A0D9RZP5_MCL1-01      ggtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctg
                                                 *                *     * 

A0A0D9RRC3_BCL2A1-      gcatttgaaggtattct---catcaagaaacttctacgacagcgaattgc
A0A0D9RJZ8_BCL2L1-      tccttcggcggggcactgtgcgtggaaag----cgtagacaagga-----
A0A0D9S017_BCL2-01      gagttcggtggggtcatgtgtgtggagag----cgtcaaccggga-----
A0A0D9RU30_BCL2L2-      gggctgcactgtg-------tgctgagag----tgtcaacaagga-----
A0A0D9RG38_BCL2L10      gggcagggtggtgtcgc---tggtgac------cttc------gc-----
A0A0D9RZP5_MCL1-01      gagttggtcggggaatc---tggtaatag----ctccagtacgga-----
                                  *              *                 *      

A0A0D9RRC3_BCL2A1-      cccggatgtggatacttataaggagatttcgtattttgttgctga-----
A0A0D9RJZ8_BCL2L1-      ----gatgcaggtattggtgagtcgg-----------atcgcagc-----
A0A0D9S017_BCL2-01      ----gatgtcgcccctggtggacaac-----------atcgccct-----
A0A0D9RU30_BCL2L2-      ----gatggaaccactggtggg-aca-----------agtgc--------
A0A0D9RG38_BCL2L10      ----ggggacgctgctggagag-aga-----------gccgctgatgaca
A0A0D9RZP5_MCL1-01      ----tgggtcactaccctcga----c-----------gccgccgccagca
                               *                                **        

A0A0D9RRC3_BCL2A1-      --------gttcataacgaataaca-------------------------
A0A0D9RJZ8_BCL2L1-      --------ttggatggccacttac--------------------------
A0A0D9S017_BCL2-01      --------gtggatgactgagtac--------------------------
A0A0D9RU30_BCL2L2-      ----aggagtggatggtggcctac--------------------------
A0A0D9RG38_BCL2L10      gcctggtggaagaagcagagcttc-----cagccgcgg------------
A0A0D9RZP5_MCL1-01      ga--ggaggaggaggacgagttgtaccggcagtcgctggagattatctct

A0A0D9RRC3_BCL2A1-      ---------cagga------------------------------------
A0A0D9RJZ8_BCL2L1-      ---------ctgaa---------tgaccac-----------------cta
A0A0D9S017_BCL2-01      ---------ctgaa--------ccggcacc------------------tg
A0A0D9RU30_BCL2L2-      ---------ctggag-acgcggctggct----------------------
A0A0D9RG38_BCL2L10      ---------ctggagcaggagggcgacgtc--------------------
A0A0D9RZP5_MCL1-01      cggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgag
                                 * * *                                    

A0A0D9RRC3_BCL2A1-      ---gaatggataaggcaaaacg-----------------------gaggc
A0A0D9RJZ8_BCL2L1-      gagccttggatccaggagaacg-----------------------gcggc
A0A0D9S017_BCL2-01      cacacctggatccaggataacg-----------------------gaggc
A0A0D9RU30_BCL2L2-      ---gactggatccacagcagtg-----------------------ggggc
A0A0D9RG38_BCL2L10      ---gcccgggactgc--cagcg-------cctggtggccttgc--tgagc
A0A0D9RZP5_MCL1-01      caggtctggggccac--cagcaggaaggctctggagaccttacgacgggt
                               **         *                             * 

A0A0D9RRC3_BCL2A1-      tgggaaaatggctttgtaaagaagtttgaacctaaatc------------
A0A0D9RJZ8_BCL2L1-      tgggac---acttttgtggaactctatgggaacaatgc------------
A0A0D9S017_BCL2-01      tgggac---gcctttgtggaactgtacggccccagcat------------
A0A0D9RU30_BCL2L2-      tgggcg---gagttcacagctctatacggggacggggccctggaggaggc
A0A0D9RG38_BCL2L10      tcg------cggctcgcggggcagcaccgcgcctggcttc--aggc----
A0A0D9RZP5_MCL1-01      tgggga---tggcgtgcagcgcaaccacgagacggccttccaaggcatgc
                        * *                                               

A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A0D9RG38_BCL2L10      ---------------------------------tcaa-------------
A0A0D9RZP5_MCL1-01      ttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcga

A0A0D9RRC3_BCL2A1-      -----------------------tggct----------------------
A0A0D9RJZ8_BCL2L1-      ---------------------agcagcc-------gagagccgaaagggc
A0A0D9S017_BCL2-01      ----------------------gcggcc---------------------t
A0A0D9RU30_BCL2L2-      ----------------------gcggcg----------------------
A0A0D9RG38_BCL2L10      ---------------------ggcggc--------------tgggatggc
A0A0D9RZP5_MCL1-01      gtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgt

A0A0D9RRC3_BCL2A1-      --ggatgactttt-------------------------------------
A0A0D9RJZ8_BCL2L1-      caggagcgcttcaaccg---------------------------------
A0A0D9S017_BCL2-01      ctgtttgatttctc------------------------------------
A0A0D9RU30_BCL2L2-      ----------tctgcgggag------------------------------
A0A0D9RG38_BCL2L10      ttttgtcacttcttcaggagcc----------------------------
A0A0D9RZP5_MCL1-01      gactctcatttcttttggtgcctttgtggctaaacacttgaagaccataa

A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A0D9RG38_BCL2L10      -------------------------------------------cctttcc
A0A0D9RZP5_MCL1-01      accaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctc

A0A0D9RRC3_BCL2A1-      -----------------ctagaagttacaggaaa-------------gat
A0A0D9RJZ8_BCL2L1-      -----------------ctggttcctgacgggca------tgactgtggc
A0A0D9S017_BCL2-01      -----------------ctggctgtctctgaagactctgctcagtttggc
A0A0D9RU30_BCL2L2-      ------------gggaactgggcatcagtgaggacagtgctgacgggggc
A0A0D9RG38_BCL2L10      g----------------ctggctttttg-gagaaaactgctgatccaggc
A0A0D9RZP5_MCL1-01      gtaaggacaaaacgggactggctagtta-aacaaagaggctgggatgggt
                                         ** *            *             *  

A0A0D9RRC3_BCL2A1-      ctgtgaaatgctatctct--------------------cctgaagcaa--
A0A0D9RJZ8_BCL2L1-      cgg-----cgtggttct--------------------gctgggctcac--
A0A0D9S017_BCL2-01      cctgg---tggga------------------------gcttgcatcac--
A0A0D9RU30_BCL2L2-      cgtggcactgggggccct-------------------ggtaactgtag--
A0A0D9RG38_BCL2L10      ttt---cctggcatgctt-------------------gttagcaacag--
A0A0D9RZP5_MCL1-01      ttg-----tggagttcttccatgtagaggacctagaaggtggcatcagaa
                                 *                                    *   

A0A0D9RRC3_BCL2A1-      ----------------tactgttga-------------------------
A0A0D9RJZ8_BCL2L1-      --------------tcttcagtcggaaatga-------------------
A0A0D9S017_BCL2-01      ----cctgggtgcctatctgggccacaag---------------------
A0A0D9RU30_BCL2L2-      ---------gggccttttttgctagcaagtga------------------
A0A0D9RG38_BCL2L10      --------------ccttcggttatctctgga----------------ca
A0A0D9RZP5_MCL1-01      atgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggca
                                        *   *                             

A0A0D9RRC3_BCL2A1-      ---------------
A0A0D9RJZ8_BCL2L1-      ---------------
A0A0D9S017_BCL2-01      ---------------
A0A0D9RU30_BCL2L2-      ---------------
A0A0D9RG38_BCL2L10      agattattatga---
A0A0D9RZP5_MCL1-01      tatctaataagatag

© 1998-2019