Dataset for CDS BCL-2-like of organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5KHH9_BCL2A1-      atgacagact-----------------gtgaatttggatatatttacagg
A0A2K5KHH9_BCL2A1-      atgacagact-----------------gtgaatttggatatatttacagg
A0A2K5KHH9_BCL2A1-      atgacagact-----------------gtgaatttggatatatttacagg
A0A2K5NZS5_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K5MMZ4_BCL2L10      atggctgaccc---gttgcgggagcgcaccgagcgg-ctc--ctggccga
A0A2K5LXU8_MCL1-02      atgtttggcct----caaaagaaacgcggtaatcggactc--aacctcta
A0A2K5LXU8_MCL1-01      atgtttggcct----caaaagaaacgcggtaatcggactc--aacctcta
A0A2K5LXU8_MCL1-03      atgtttggcct----caaaagaaacgcggtaatcggactc--aacctcta
A0A2K5M8B1_BCL2L1-      ------------------atgtctcagagcaaccgggagctggtggttga
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      atggcgacccc---agcctcggccccagacacacgggctctggtggcaga
A0A2K5MZX9_BCL2L2-      atggcgacccc---agcctcggccccagacacacgggctctggtggcaga

A0A2K5KHH9_BCL2A1-      ctagctc-------------------aggacta-----------------
A0A2K5KHH9_BCL2A1-      ctagctc-------------------aggacta-----------------
A0A2K5KHH9_BCL2A1-      ctagctc-------------------aggacta-----------------
A0A2K5NZS5_BCL2-01      gtacatccactataagctgtcgcagaggggctacgag-------------
A0A2K5MMZ4_BCL2L10      ctat------------------ctggggtgctgcgcc-------------
A0A2K5LXU8_MCL1-02      ctgt-------------------gggggggccg-gct-------------
A0A2K5LXU8_MCL1-01      ctgt-------------------gggggggccg-gct-------------
A0A2K5LXU8_MCL1-03      ctgt-------------------gggggggccg-gct-------------
A0A2K5M8B1_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcaattta
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      ctttgtaggttataagctgaggcagaagggttatgtc-------------
A0A2K5MZX9_BCL2L2-      ctttgtaggttataagctgaggcagaagggttatgtc-------------

A0A2K5KHH9_BCL2A1-      ----tttgcagtacgttctgcagataccacaacctggatcgggtccaa--
A0A2K5KHH9_BCL2A1-      ----tttgcagtacgttctgcagataccacaacctggatcgggtccaa--
A0A2K5KHH9_BCL2A1-      ----tttgcagtacgttctgcagataccacaacctggatcgggtccaa--
A0A2K5NZS5_BCL2-01      ----tgggatgcgggggatgtgggcgcggcgacccctggggtcgcccccg
A0A2K5MMZ4_BCL2L10      ----cggga---acc-----------cggcacccctgagccgaggccgtc
A0A2K5LXU8_MCL1-02      ----tgggg---gccggcagcggcggcgccacccctccgggagggcggct
A0A2K5LXU8_MCL1-01      ----tgggg---gccggcagcggcggcgccacccctccgggagggcggct
A0A2K5LXU8_MCL1-03      ----tgggg---gccggcagcggcggcgccacccctccgggagggcggct
A0A2K5M8B1_BCL2L1-      gtgatgtgg---aagagaacagga--ctgaggccccagaagggactgaat
A0A2K5M8B1_BCL2L1-      ---atgtgg---aagagaacagga--ctgaggccccagaagggactgaat
A0A2K5MZX9_BCL2L2-      ----tgtgg---a----------g--ct--ggccctggggagggccca--
A0A2K5MZX9_BCL2L2-      ----tgtgg---a----------g--ct--ggccctggggagggccca--
                               *                  *     **                

A0A2K5KHH9_BCL2A1-      -gcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaaga
A0A2K5KHH9_BCL2A1-      -gcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaaga
A0A2K5KHH9_BCL2A1-      -gcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaaga
A0A2K5NZS5_BCL2-01      caccgggcatcttctcctcccagcccgggcacacgccccatcccgccgcg
A0A2K5MMZ4_BCL2L10      cacgc------------cc-------------------------------
A0A2K5LXU8_MCL1-02      tttgg------------ctacggagaaggaggcctcggcccggcgagaga
A0A2K5LXU8_MCL1-01      tttgg------------ctacggagaaggaggcctcggcccggcgagaga
A0A2K5LXU8_MCL1-03      ttt-----------------------------------------------
A0A2K5M8B1_BCL2L1-      cggag------------atggagacccccagtgccatcaatggcaaccca
A0A2K5M8B1_BCL2L1-      cggag------------atggagacccccagtgccatcaatggcaaccca
A0A2K5MZX9_BCL2L2-      -gcag------------ct---gacccgctgcac---------caagcca
A0A2K5MZX9_BCL2L2-      -gcag------------ct---gacccgctgcac---------caagcca

A0A2K5KHH9_BCL2A1-      agtggaaa------------------------------------------
A0A2K5KHH9_BCL2A1-      agtggaaa------------------------------------------
A0A2K5KHH9_BCL2A1-      agtggaaa------------------------------------------
A0A2K5NZS5_BCL2-01      tcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccc
A0A2K5MMZ4_BCL2L10      ---------------gaggccgccgtgctg--------------------
A0A2K5LXU8_MCL1-02      taggggga----ggggaggccggcacggtgattggcggaagcgccggcgc
A0A2K5LXU8_MCL1-01      taggggga----ggggaggccggcacggtgattggcggaagcgccggcgc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      tcctggcacctggtggacagccccgcggtgaatggagccactggccacag
A0A2K5M8B1_BCL2L1-      tcct----------------------------------------------
A0A2K5MZX9_BCL2L2-      tgcgggca------------------------------------------
A0A2K5MZX9_BCL2L2-      tgcgggca------------------------------------------

A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      cgccgccgccgcggggcctgcgctcagcccggtgccacctgtggtccacc
A0A2K5MMZ4_BCL2L10      ------------------------------------------cgctcagc
A0A2K5LXU8_MCL1-02      aagccccccggccgccctcacgccagacgcccggagg---gtcgcgcggc
A0A2K5LXU8_MCL1-01      aagccccccggccgccctcacgccagacgcccggagg---gtcgcgcggc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      cagcagtttggatgcccgggaggtgatccccatggca---gcagtaaagc
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------

A0A2K5KHH9_BCL2A1-      ----------agaatctgaagcc----atgcttggacaatgttaatgttg
A0A2K5KHH9_BCL2A1-      ----------agaatctgaagcc----atgcttggacaatgttaatgttg
A0A2K5KHH9_BCL2A1-      ----------agaatctgaagcc----atgcttggacaatgttaatgttg
A0A2K5NZS5_BCL2-01      tgaccctccgccaggccggtgac----gacttctcccgccgctaccgccg
A0A2K5MMZ4_BCL2L10      agccgcc--------------------aggttacggcagctccaccggtc
A0A2K5LXU8_MCL1-02      cgccgcccattggcgcggaggtccccgacgtcaccgcgacccccgcgagg
A0A2K5LXU8_MCL1-01      cgccgcccattggcgcggaggtccccgacgtcaccgcgacccccgcgagg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      aagcgctgagggaggcaggcgac----gagtttgaactgcggtaccggcg
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------gctggagat----gagttcgagacccgcttccggcg
A0A2K5MZX9_BCL2L2-      --------------gctggagat----gagttcgagacccgcttccggcg

A0A2K5KHH9_BCL2A1-      cat-----------------------------------------------
A0A2K5KHH9_BCL2A1-      cat-----------------------------------------------
A0A2K5KHH9_BCL2A1-      cat-----------------------------------------------
A0A2K5NZS5_BCL2-01      cgacttcgccgagatgtcc-------------------------------
A0A2K5MMZ4_BCL2L10      cttcttctc----cgccta-------------------------------
A0A2K5LXU8_MCL1-02      ctgcttttctttgcgcccacccgccgcgcggcgccgcttgaggagatgga
A0A2K5LXU8_MCL1-01      ctgcttttctttgcgcccacccgccgcgcggcgccgcttgaggagatgga
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ggcgttcagtgacctgaca-------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      caccttctctgatctggcg-------------------------------
A0A2K5MZX9_BCL2L2-      caccttctctgatctggcg-------------------------------

A0A2K5KHH9_BCL2A1-      --------------------ccatagacactgccagaacactattcaatc
A0A2K5KHH9_BCL2A1-      --------------------ccatagacactgccagaacactattcaatc
A0A2K5KHH9_BCL2A1-      --------------------ccatagacactgccagaacactattcaatc
A0A2K5NZS5_BCL2-01      --agccagctgcacctgacgcccttcaccgcgcggggacgctttgccac-
A0A2K5MMZ4_BCL2L10      --ccgcggctaccgcgggaaccgcgtc----------gagctgg------
A0A2K5LXU8_MCL1-02      agccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggt
A0A2K5LXU8_MCL1-01      agccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggt
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --tcccagctccacatcaccccagggacagcatatcagagctttgaaca-
A0A2K5M8B1_BCL2L1-      -----------------------gggacagcatatcagagctttgaaca-
A0A2K5MZX9_BCL2L2-      --gctcagctgcatgtgaccccaggctcagcacagcaacgcttcaccca-
A0A2K5MZX9_BCL2L2-      --gctcagctgcatgtgaccccaggctcagcacagcaacgcttcaccca-

A0A2K5KHH9_BCL2A1-      a-----------------------------------agtgatggaaaagg
A0A2K5KHH9_BCL2A1-      a-----------------------------------agtgatggaaaagg
A0A2K5KHH9_BCL2A1-      a-----------------------------------agtgatggaaaagg
A0A2K5NZS5_BCL2-01      ------------------------------------ggtggtggaggagc
A0A2K5MMZ4_BCL2L10      ------------------------------------tggcgctgatggcg
A0A2K5LXU8_MCL1-02      acgagccggagcctctcgggaagcggccggctgtcctgcccctgctggag
A0A2K5LXU8_MCL1-01      acgagccggagcctctcgggaagcggccggctgtcctgcccctgctggag
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ------------------------------------ggtagtgaatgaac
A0A2K5M8B1_BCL2L1-      ------------------------------------ggtagtgaatgaac
A0A2K5MZX9_BCL2L2-      ------------------------------------ggtctccgatgaac
A0A2K5MZX9_BCL2L2-      ------------------------------------ggtctccgatgaac

A0A2K5KHH9_BCL2A1-      aatttgaagat---------------------------------------
A0A2K5KHH9_BCL2A1-      aatttgaagat---------------------------------------
A0A2K5KHH9_BCL2A1-      aatttgaagat---------------------------------------
A0A2K5NZS5_BCL2-01      tcttcagggac---------------------------------------
A0A2K5MMZ4_BCL2L10      gaggccgtgctctccgacag--------------------------cccc
A0A2K5LXU8_MCL1-02      ttggtcggggaatctggtaatagccccagtacggatgggtcactaccctc
A0A2K5LXU8_MCL1-01      ttggtcggggaatctggtaatagccccagtacggatgggtcactaccctc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      tcttccgggat---------------------------------------
A0A2K5M8B1_BCL2L1-      tcttccgggat---------------------------------------
A0A2K5MZX9_BCL2L2-      ttttccaaggg---------------------------------------
A0A2K5MZX9_BCL2L2-      ttttccaaggg---------------------------------------

A0A2K5KHH9_BCL2A1-      ggcatcattaactggggaagaattg-------------------------
A0A2K5KHH9_BCL2A1-      ggcatcattaactggggaagaattg-------------------------
A0A2K5KHH9_BCL2A1-      ggcatcattaactggggaagaattg-------------------------
A0A2K5NZS5_BCL2-01      ggggtg---aactgggggaggatcg-------------------------
A0A2K5MMZ4_BCL2L10      ggcccc---acctggggcagggtgg-------------------------
A0A2K5LXU8_MCL1-02      gacgcc---gccgccagcagaggaggaggaggacgagttgtaccggcagt
A0A2K5LXU8_MCL1-01      gacgcc---gccgccagcagaggaggaggaggacgagttgtaccggcagt
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ggggtg---aactggggtcgcattg-------------------------
A0A2K5M8B1_BCL2L1-      ggggtg---aactggggtcgcattg-------------------------
A0A2K5MZX9_BCL2L2-      ggcccc---aactggggccgccttg-------------------------
A0A2K5MZX9_BCL2L2-      ggcccc---aactggggccgccttg-------------------------

A0A2K5KHH9_BCL2A1-      ----------taaccatatttgcatttgaaggtattctcatcaagaaact
A0A2K5KHH9_BCL2A1-      ----------taaccatatttgcatttgaaggtattctcatcaagaaact
A0A2K5KHH9_BCL2A1-      ----------taaccatatttgcatttgaaggtattctcatcaagaaact
A0A2K5NZS5_BCL2-01      ----------tggccttctttgagttcggtggggtcatgtgtgtggagag
A0A2K5MMZ4_BCL2L10      ----------tgtcgctggtgaccttcgcggggacgctgc----------
A0A2K5LXU8_MCL1-02      cgctggagattatctctcggtaccttcgggagcaggccac----------
A0A2K5LXU8_MCL1-01      cgctggagattatctctcggtaccttcgggagcaggccac----------
A0A2K5LXU8_MCL1-03      ----------------------------------ggccac----------
A0A2K5M8B1_BCL2L1-      ----------tggcctttttctccttcggcggggcactgtgcgtggaaag
A0A2K5M8B1_BCL2L1-      ----------tggcctttttctccttcggcggggcactgtgcgtggaaag
A0A2K5MZX9_BCL2L2-      ----------tagccttctttgtctttggggctgcactgtgtgctgagag
A0A2K5MZX9_BCL2L2-      ----------tagccttctttgtctttggggctgcactgtgtgctgagag

A0A2K5KHH9_BCL2A1-      tctacgacagcgaattgccccggatgtggatacttat---aaggagattt
A0A2K5KHH9_BCL2A1-      tctacgacagcgaattgccccggatgtggatacttat---aaggagattt
A0A2K5KHH9_BCL2A1-      tctacgacagcgaattgccccggatgtggatacttat---aaggagattt
A0A2K5NZS5_BCL2-01      cgt-caaccggga---------gatgtcgcccctggtg--gacaacatcg
A0A2K5MMZ4_BCL2L10      ---------tgga---------gagagagccgctggtgacagcctggtgg
A0A2K5LXU8_MCL1-02      ---------cggc---------gccaaggacac-----aaagccaatggg
A0A2K5LXU8_MCL1-01      ---------cggc---------gccaaggacac-----aaagccaatggg
A0A2K5LXU8_MCL1-03      ---------cggc---------gccaaggacac-----aaagccaatggg
A0A2K5M8B1_BCL2L1-      cgt-agacaagga---------gatgcaggtattggtg--agtcggatcg
A0A2K5M8B1_BCL2L1-      cgt-agacaagga---------gatgcaggtattggtg--agtcggatcg
A0A2K5MZX9_BCL2L2-      tgt-caacaagga---------gatggaaccactggtg--ggacaagtgc
A0A2K5MZX9_BCL2L2-      tgt-caacaagga---------gatggaaccactggtg--ggacaagtgc
                                   *          *                           

A0A2K5KHH9_BCL2A1-      cgtattttgttgctgagttcat-----aatgaataacaca----------
A0A2K5KHH9_BCL2A1-      cgtattttgttgctgagttcat-----aatgaataacaca----------
A0A2K5KHH9_BCL2A1-      cgtattttgttgctgagttcat-----aatgaataacaca----------
A0A2K5NZS5_BCL2-01      ccctgtggatgactgagtacct-----gaaccggcacctg----------
A0A2K5MMZ4_BCL2L10      aagaagcgg-ggcttccagccgcggctgaaggagcaggag----------
A0A2K5LXU8_MCL1-02      caggtctgg-ggccaccagcag-----gaaggctctggagaccttacgac
A0A2K5LXU8_MCL1-01      caggtctgg-ggccaccagcag-----gaaggctctggagaccttacgac
A0A2K5LXU8_MCL1-03      caggtctgg-ggccaccagcag-----gaaggctctggagaccttacgac
A0A2K5M8B1_BCL2L1-      cagcttggatggccacttacct-----gaatgaccaccta----------
A0A2K5M8B1_BCL2L1-      cagcttggatggccacttacct-----gaatgaccaccta----------
A0A2K5MZX9_BCL2L2-      aggagtggatggtggcctacct-----ggagacgcggctg----------
A0A2K5MZX9_BCL2L2-      aggagtggatggtggcctacct-----ggagacgcggctg----------

A0A2K5KHH9_BCL2A1-      -----ggagaatggataaggcaaaacggaggctgggggaaatggc-----
A0A2K5KHH9_BCL2A1-      -----ggagaatggataaggcaaaacggaggct-gggaaaatggctttgt
A0A2K5KHH9_BCL2A1-      -----ggagaatggataaggcaaaacggaggct-gggaaaatggctttgt
A0A2K5NZS5_BCL2-01      -----cacacctggatccaggataacggaggctgggac------gccttt
A0A2K5MMZ4_BCL2L10      -----ggcgacgtcgcccgggactgccagcgcctggtg-----gccttgc
A0A2K5LXU8_MCL1-02      gggttggggatggcgtgcag---cgcaaccacgagacg-----gccttcc
A0A2K5LXU8_MCL1-01      gggttggggatggcgtgcag---cgcaaccacgagacg-----gccttcc
A0A2K5LXU8_MCL1-03      gggttggggatggcgtgcag---cgcaaccacgagacg-----gccttcc
A0A2K5M8B1_BCL2L1-      -----gagccttggatccaggagaacggcggctgggac------actttt
A0A2K5M8B1_BCL2L1-      -----gagccttggatccaggagaacggcggctgggac------actttt
A0A2K5MZX9_BCL2L2-      -----gctgactggatccacagcagtgggggctgggagctggaagctatc
A0A2K5MZX9_BCL2L2-      -----gctgactggatccacagcagtgggggctgggcg------gagttc
                                                       *  *               

A0A2K5KHH9_BCL2A1-      --acaatcacatgcct----------------------------------
A0A2K5KHH9_BCL2A1-      aaagaagcttgagcct----------------------------------
A0A2K5KHH9_BCL2A1-      aaagaagtttgaacct----------------------------------
A0A2K5NZS5_BCL2-01      gtggaactgtacggcc----------------------------------
A0A2K5MMZ4_BCL2L10      tgagctcgc-----------------------------------------
A0A2K5LXU8_MCL1-02      aa------------------------------------------------
A0A2K5LXU8_MCL1-01      aaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcc
A0A2K5LXU8_MCL1-03      aaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcc
A0A2K5M8B1_BCL2L1-      gtggaactctatggga----------------------------------
A0A2K5M8B1_BCL2L1-      gtggaactctatggga----------------------------------
A0A2K5MZX9_BCL2L2-      aaagctcgagtcagggagatggaggaagaagctgagaagctaaaggagct
A0A2K5MZX9_BCL2L2-      acagctctatacgggg----------------------------------

A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      ttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactgggg
A0A2K5LXU8_MCL1-03      ttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactgggg
A0A2K5M8B1_BCL2L1-      -----acaatg---------------------------------------
A0A2K5M8B1_BCL2L1-      -----acaatg---------------------------------------
A0A2K5MZX9_BCL2L2-      acagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatg
A0A2K5MZX9_BCL2L2-      -----acgggg---------------------------------------

A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      caggattgtgactctcatttcttttggtgcctttgtggctaaacacttga
A0A2K5LXU8_MCL1-03      caggattgtgactctcatttcttttggtgcctttgtggctaaacacttga
A0A2K5M8B1_BCL2L1-      ---------------------------------cagcagccg--------
A0A2K5M8B1_BCL2L1-      ---------------------------------cagcagccg--------
A0A2K5MZX9_BCL2L2-      ctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgt
A0A2K5MZX9_BCL2L2-      ------------------ccctggaggaggcg-cggcgtctg--------

A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      agaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcaca
A0A2K5LXU8_MCL1-03      agaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcaca
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      tccatctatgttggcaatgtgga---------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------

A0A2K5KHH9_BCL2A1-      ----------------------atg-ctag--------------------
A0A2K5KHH9_BCL2A1-      ----------------------aaatctgg--------------------
A0A2K5KHH9_BCL2A1-      ----------------------aaatctgg--------------------
A0A2K5NZS5_BCL2-01      --------------------------ccag--------------------
A0A2K5MMZ4_BCL2L10      ----ggctcgcggggcagcaccgcgcctgg--------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      gacgttctcgtaaggacaaaacgggactgg--------------------
A0A2K5LXU8_MCL1-03      gacgttctcgtaaggacaaaacgggactgg--------------------
A0A2K5M8B1_BCL2L1-      ----------------------agagccga--------------------
A0A2K5M8B1_BCL2L1-      ----------------------agagccga--------------------
A0A2K5MZX9_BCL2L2-      ----ctatggtgcaacagcagaagagctggaagctcactttcatggctgt
A0A2K5MZX9_BCL2L2-      ---------------cgggaggggaactgg--------------------

A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      ggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcc
A0A2K5MZX9_BCL2L2-      --------------------------------------------------

A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      ------------------------------catgcggcctctgtttgatt
A0A2K5MMZ4_BCL2L10      ---------------------cttcaggctcagggcggctgggatggctt
A0A2K5LXU8_MCL1-02      -----------------------------------------ggatgggtt
A0A2K5LXU8_MCL1-01      ---------------------ctagttaaacaaagaggctgggatgggtt
A0A2K5LXU8_MCL1-03      ---------------------ctagttaaacaaagaggctgggatgggtt
A0A2K5M8B1_BCL2L1-      --------------------------------aagggccag-gagcgctt
A0A2K5M8B1_BCL2L1-      --------------------------------aagggccag-gagcgctt
A0A2K5MZX9_BCL2L2-      caaaggatttgcgtatatagagttctcagacaaagagtcagtgaggactt
A0A2K5MZX9_BCL2L2-      ----------------------------------gcatcagtgaggac--

A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      tctcc----------------------------------------tggct
A0A2K5MMZ4_BCL2L10      ttgtcac------------ttcttca----ggagcccctttccgctggct
A0A2K5LXU8_MCL1-02      tgtggag------------ttcttccatgtagaggacctagaaggtggc-
A0A2K5LXU8_MCL1-01      tgtggag------------ttcttccatgtagaggacctagaaggtggc-
A0A2K5LXU8_MCL1-03      tgtggag------------ttcttccatgtagaggacctagaaggtggc-
A0A2K5M8B1_BCL2L1-      caaccgc--------------------------------------tggtt
A0A2K5M8B1_BCL2L1-      caaccgc--------------------------------------tggtt
A0A2K5MZX9_BCL2L2-      ccttggccttagatgagtccctatttagaggaaggcaaatcaaggtgatc
A0A2K5MZX9_BCL2L2-      -------------------------------------------agtg---

A0A2K5KHH9_BCL2A1-      ----------------------------------tagag-----------
A0A2K5KHH9_BCL2A1-      ----------------------------------ctgga-----------
A0A2K5KHH9_BCL2A1-      ----------------------------------ctgga-----------
A0A2K5NZS5_BCL2-01      gtct------------------------------ctgaagact-------
A0A2K5MMZ4_BCL2L10      tt--------------------------------ttggagaaca------
A0A2K5LXU8_MCL1-02      at--------------------------------cagaaatgtg------
A0A2K5LXU8_MCL1-01      at--------------------------------cagaaatgtg------
A0A2K5LXU8_MCL1-03      at--------------------------------cagaaatgtg------
A0A2K5M8B1_BCL2L1-      c---------------------------------ctgacgggca------
A0A2K5M8B1_BCL2L1-      c---------------------------------ctgacgggca------
A0A2K5MZX9_BCL2L2-      ccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttcc
A0A2K5MZX9_BCL2L2-      ----------------------------------ctgacggggg------

A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5KHH9_BCL2A1-      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A2K5MMZ4_BCL2L10      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      acgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctc
A0A2K5MZX9_BCL2L2-      --------------------------------------------------

A0A2K5KHH9_BCL2A1-      -----------------tcagtggcccacaggaagaagaa------aatg
A0A2K5KHH9_BCL2A1-      -----------------tgacttttctagaagttacagga------aaga
A0A2K5KHH9_BCL2A1-      -----------------tgacttttctagaagttacagga------aaga
A0A2K5NZS5_BCL2-01      -------ctgctcagtttggccctggtgggagcttgcatcaccctgggtg
A0A2K5MMZ4_BCL2L10      -------ctgc------tga----tccaggctttcctggcatgcttgtta
A0A2K5LXU8_MCL1-02      -------ctgc------tggctgttgcaggtgttgctgg-------agta
A0A2K5LXU8_MCL1-01      -------ctgc------tggctgttgcaggtgttgctgg-------agta
A0A2K5LXU8_MCL1-03      -------ctgc------tggctgttgcaggtgttgctgg-------agta
A0A2K5M8B1_BCL2L1-      ----tgactg-------tggc---------------cggcgt----ggt-
A0A2K5M8B1_BCL2L1-      ----tgactg-------tggc---------------cggcgt----ggt-
A0A2K5MZX9_BCL2L2-      gattctacag-------tggttttaacagcaggccccggggt----cgtg
A0A2K5MZX9_BCL2L2-      -------ccg-------tggc----actgggggccctg---------gta

A0A2K5KHH9_BCL2A1-      gctttgtaa-----------------------------------------
A0A2K5KHH9_BCL2A1-      tctgtgaaatgc---------------------tctctcttctgaagcaa
A0A2K5KHH9_BCL2A1-      tctgtgaaatgc---------------------tatctctcctgaagcaa
A0A2K5NZS5_BCL2-01      cctatctgggcc------------------------------acaagtga
A0A2K5MMZ4_BCL2L10      gcaacagccttc------------------ggttatct--ctggacacga
A0A2K5LXU8_MCL1-02      ggagctggtttg------------------gcatatctaataagatagcc
A0A2K5LXU8_MCL1-01      ggagctggtttg------------------gcatatctaataagatag--
A0A2K5LXU8_MCL1-03      ggagctggtttg------------------gcatatctaataagatag--
A0A2K5M8B1_BCL2L1-      tctgctgggctc-------------------actcttcagtcggaaatga
A0A2K5M8B1_BCL2L1-      tctgctgggctc-------------------actcttcagtcggaaatga
A0A2K5MZX9_BCL2L2-      tctacaggggccgggctagagcgacatcatggtattccccttac---taa
A0A2K5MZX9_BCL2L2-      actgtaggggcc--------------------ttttttgctagcaagtga

A0A2K5KHH9_BCL2A1-      ---------
A0A2K5KHH9_BCL2A1-      tactgttga
A0A2K5KHH9_BCL2A1-      tactgttga
A0A2K5NZS5_BCL2-01      ---------
A0A2K5MMZ4_BCL2L10      ttattatga
A0A2K5LXU8_MCL1-02      ttactgtaa
A0A2K5LXU8_MCL1-01      ---------
A0A2K5LXU8_MCL1-03      ---------
A0A2K5M8B1_BCL2L1-      ---------
A0A2K5M8B1_BCL2L1-      ---------
A0A2K5MZX9_BCL2L2-      ---------
A0A2K5MZX9_BCL2L2-      ---------

© 1998-2019