Dataset for CDS BCL2L1 of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452FIG6_BCL2L1-      atgtctcagagcaaccgagagctggtggttgactttctctcttacaagct
A0A452FIG6_BCL2L1-      atgtctcagagcaaccgagagctggtggttgactttctctcttacaagct
A0A452E1B1_BCL2L1-      atgtctcagagcaaccgggaactagtggttgactttctctcttacaagtt
A0A452FWV3_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcttacaagct
                        ***************** ** ** ************************ *

A0A452FIG6_BCL2L1-      ttcccagaaaggattcagctggag--------------------------
A0A452FIG6_BCL2L1-      ttcccagaaaggattcagctggag--------------------------
A0A452E1B1_BCL2L1-      tttccagaaaggatacagctggagtcagtttagtgatatggaagagaaca
A0A452FWV3_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
                        ** *********** *********                          

A0A452FIG6_BCL2L1-      ---------cctcagaagggacaaaatcagatatggaaa-ccccaatgcc
A0A452FIG6_BCL2L1-      ---------cctcagaagggacaaaatcagatatggaaa-ccccaatgcc
A0A452E1B1_BCL2L1-      gaactgagaccctagaagggacagaatcagatatggaaacccccagcgcc
A0A452FWV3_BCL2L1-      gaactgaggccccagaagggacagaatcagatatggaaacccccagtgcc
                                 **  ********** *************** *****  ***

A0A452FIG6_BCL2L1-      gtcaatgccaacccatcttggcacctggcgcatagccctgcggtgaatgg
A0A452FIG6_BCL2L1-      gtcaatgccaacccatcttggcacctggcgcatagccctgcggtgaatgg
A0A452E1B1_BCL2L1-      atcagtggcaacccatcctggcacctggcagatagctctgtggtgaatgg
A0A452FWV3_BCL2L1-      atcaatggcaacccatcttggcacctggcggatagccctgcggtgaatgg
                         *** ** ********* ***********  ***** *** *********

A0A452FIG6_BCL2L1-      agccactggccaca-cagaa-------------gaaagtggt-cctgtgg
A0A452FIG6_BCL2L1-      agccactggccaca-cagaa-------------gaaagtggt-cctgtgg
A0A452E1B1_BCL2L1-      agccactggtcacagcagaagcttggacgctgggaaaatgatccccacgg
A0A452FWV3_BCL2L1-      agccaccggccacagcagaagcttggatgcccgggaagtgatccccatgg
                        ****** ** **** *****             * ** ** * **   **

A0A452FIG6_BCL2L1-      caacagcacagcaagccccgagggaggcaggcagcgagtttgaactgagg
A0A452FIG6_BCL2L1-      caacagcacagcaagccccgagggaggcaggcagcgagtttgaactgagg
A0A452E1B1_BCL2L1-      cagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgagg
A0A452FWV3_BCL2L1-      cagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgagg
                        **   *   ********* ********** **   **** **** *****

A0A452FIG6_BCL2L1-      caccaacagacggtcagcgacctgacgtcccagctccacaccaccccagg
A0A452FIG6_BCL2L1-      caccaacagacggtcagcgacctgacgtcccagctccacaccaccccagg
A0A452E1B1_BCL2L1-      taccaacagacattcagcgacctgacgtcccagctccacatcaccccagg
A0A452FWV3_BCL2L1-      taccgacgggcattcagcgacctgacgtcccagctccacattaccccagg
                         *** ** * *  ***************************  ********

A0A452FIG6_BCL2L1-      gacagcatatcagagctttgaacaggtaatgtatgagctcttctgggacg
A0A452FIG6_BCL2L1-      gacagcatatcagagctttgaacaggtaatgtatgagctcttctgggacg
A0A452E1B1_BCL2L1-      gacaacatatcagagctttgaacaggtaataaatgaactcttccaggatg
A0A452FWV3_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
                        **** *********************** *  **** ******  *** *

A0A452FIG6_BCL2L1-      gggtgaactgggatcacactgtggcctttttctccttcaggggggcacta
A0A452FIG6_BCL2L1-      gggtgaactgggatcacactgtggcctttttctccttcaggggggcacta
A0A452E1B1_BCL2L1-      gggtgaactggtgtcgcaatgtggcctttttctccttcggtggggcacta
A0A452FWV3_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
                        ***********  ** ** ******************* * ******** 

A0A452FIG6_BCL2L1-      tgcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtcat
A0A452FIG6_BCL2L1-      tgcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtcat
A0A452E1B1_BCL2L1-      tgcatgaaaagcatagtcaaggagatgcaggtattggtaagtcaggtcac
A0A452FWV3_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                        *** ** ***** *** ********************* **** * **  

A0A452FIG6_BCL2L1-      gacttggatggccagccagctaaatgaccacctagagccttggatccagg
A0A452FIG6_BCL2L1-      gacttggatggccagccagctaaatgaccacctagagccttggatccagg
A0A452E1B1_BCL2L1-      gacttggatggccacttacctaaataaccacctagagccttggatccagg
A0A452FWV3_BCL2L1-      aacttggatggctacttacctgaatgaccacctagagccttggatccagg
                         *********** *   * ** *** ************************

A0A452FIG6_BCL2L1-      agaatggcggctgggacacttctgtggaattctgtgaaaacaatacagca
A0A452FIG6_BCL2L1-      agaatggcggctgggacacttctgtggaattctgtgaaaacaatacagca
A0A452E1B1_BCL2L1-      agaatggcgactgggacatttttgtggaactctacgaaaacaatacagca
A0A452FWV3_BCL2L1-      agaacggcggctgggacacgtttgtggaactctatgggaacaacgcagca
                        **** **** ********  * ******* ***  *  *****  *****

A0A452FIG6_BCL2L1-      accgagagccaaaagggccaggagcgcttcaactgctggtccctgacggc
A0A452FIG6_BCL2L1-      accgagagccaaaagggccaggagcgcttcaactgctggtccctgacggc
A0A452E1B1_BCL2L1-      accgagagccaaaagggccaagagcacttcaaccgctggtccctgacgga
A0A452FWV3_BCL2L1-      gccgagagccggaagggccaggagcgcttcaaccgctggttcctgacggg
                         *********  ******** **** ******* ****** ******** 

A0A452FIG6_BCL2L1-      tgtgactttggctggg---ggatcaggactcagcaggaaggcagctgtct
A0A452FIG6_BCL2L1-      tgtgactttggctgggctcgctcttcaactcatagtgactgttcctttca
A0A452E1B1_BCL2L1-      cgtgactgtggctggtatggctctg-------------------------
A0A452FWV3_BCL2L1-      catgactgtggctggtgtggttctg-------------------------
                          ***** *******    *                              

A0A452FIG6_BCL2L1-      ctaaagataccc--------------cttggctcaccttcccctctcccc
A0A452FIG6_BCL2L1-      ttacagtcattcatgttttgcacaagcttgtgttcccttccttttgttac
A0A452E1B1_BCL2L1-      --------------------------ctgggcttgctcttca--------
A0A452FWV3_BCL2L1-      --------------------------ctgggctcgctcttca--------
                                                  ** *  *  *  * *         

A0A452FIG6_BCL2L1-      atgctcaag----cctac----tga
A0A452FIG6_BCL2L1-      a-gctatagagaccttacaatttaa
A0A452E1B1_BCL2L1-      --ac---aca------------taa
A0A452FWV3_BCL2L1-      --gtcggaaa------------tga
                               *              * *

© 1998-2019