Dataset for CDS BCL-2 of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A076FU27_BCL2-01      atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaa
A0A076FZV9_BCL2-01      atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaa

A0A076FU27_BCL2-01      gtacatccactacaagctgtcgcagcgcggctacgagtgggatgccagag
A0A076FZV9_BCL2-01      gtacatccactacaagctgtcgcagcgcggctacgagtgggatgccggag
                        ********************************************** ***

A0A076FU27_BCL2-01      ccgcgggcgccgcgccccccggggccgcccccgcgccgggcatcctgtcc
A0A076FZV9_BCL2-01      ccgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcc
                        **************************** *********************

A0A076FU27_BCL2-01      tcccagccgggccgcacacccgcgccctccaggacctccccgccgccgcc
A0A076FZV9_BCL2-01      tcccagccgggccgcacacccgcgccctccaggacctccccgccgccgcc

A0A076FU27_BCL2-01      cccggccgccgccgccgggcctgcgcccagcccggtgccacctgtggtcc
A0A076FZV9_BCL2-01      cccggccgccgccgccgggcctgcgcccagcccggtgccacctgtggtcc

A0A076FU27_BCL2-01      acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
A0A076FZV9_BCL2-01      acctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc

A0A076FU27_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgag
A0A076FZV9_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgag

A0A076FU27_BCL2-01      gggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
A0A076FZV9_BCL2-01      gggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact

A0A076FU27_BCL2-01      gggggcgcatcgtggccttctttgagttcggaggggtcatatgtgtggag
A0A076FZV9_BCL2-01      gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggag
                        **************************************** *********

A0A076FU27_BCL2-01      agcgtcaaccgggagatgtcgcccctggtggacagcatcgccctgtggat
A0A076FZV9_BCL2-01      agcgtcaaccgggagatgtcgcccctggtggacagcatcgccctgtggat

A0A076FU27_BCL2-01      gaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggag
A0A076FZV9_BCL2-01      gaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggag

A0A076FU27_BCL2-01      gctgggacgcctttgtggagctgtacggccctagcatgcggcccctgttt
A0A076FZV9_BCL2-01      gctgggacgcctttgtggagctgtacggccctagcatgcggcccctgttt

A0A076FU27_BCL2-01      gatttctcctggctgtctctgaaggcactgctcagtctggccctggtggg
A0A076FZV9_BCL2-01      gatttctcctggctgtctctgaaggcactgctcagtctggccctggtggg

A0A076FU27_BCL2-01      cgcttgcatcaccctgggtgcctatctgggccataagtga
A0A076FZV9_BCL2-01      cgcttgcatcaccctgggtgcctatctgggccataagtga

© 1998-2019