Dataset for CDS MCL-1 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


J9PBC4_MCL1-01      atgttcggcctcaagagaaacgcagtaat-cggactcaacctctactgtgggggggccgg
J9PBC4_MCL1-02      atgttcggcctcaagagaaacgcagtaat-cggactcaacctctactgtgggggggccgg
Q8HYS5_MCL1-01      atgtttggcctcaagagaaacgcagtaatccggactcaa-ctctactgtgggggggccgg
                    ***** *********************** ********* ********************

J9PBC4_MCL1-01      gctgggggccggcagcggcggcgcctcctcttcgggagggcggcttttggcttcggggaa
J9PBC4_MCL1-02      gctgggggccggcagcggcggcgcctcctcttcgggagggcggcttttggcttcggggaa
Q8HYS5_MCL1-01      gctgggggccggcagcggcggcgcctcctcttcgggagggcggcttttggcttcggggag
                    *********************************************************** 

J9PBC4_MCL1-01      ggaggccacgaccagacgggagggagggggaggggaagccggtgcggtgattggcggaag
J9PBC4_MCL1-02      ggaggccacgaccagacgggagggagggggaggggaagccggtgcggtgattggcggaag
Q8HYS5_MCL1-01      ggaggccacgaccagacgggagggagggggaggggaagccggtgcggtgattggcggaag
                    ************************************************************

J9PBC4_MCL1-01      cgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctc
J9PBC4_MCL1-02      cgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctc
Q8HYS5_MCL1-01      cgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctc
                    ************************************************************

J9PBC4_MCL1-01      acccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgc
J9PBC4_MCL1-02      acccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgc
Q8HYS5_MCL1-01      acccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgc
                    ************************************************************

J9PBC4_MCL1-01      gcccccctgccgcgcgtcgccgcctgaagagatggaaggcccggccgccgacgccatcat
J9PBC4_MCL1-02      gcccccctgccgcgcgtcgccgcctgaagagatggaaggcccggccgccgacgccatcat
Q8HYS5_MCL1-01      gcccccctgccgcgcgtcgccgcctgaagagatggaaggcccggccgccgacgccatcat
                    ************************************************************

J9PBC4_MCL1-01      gtcgcccgaagaggagctagacgggtacgagccggaacctttggggaagcggccggcggt
J9PBC4_MCL1-02      gtcgcccgaagaggagctagacgggtacgagccggaacctttggggaagcggccggcggt
Q8HYS5_MCL1-01      gtcgcccgaagaggagctagacgggtacgagccggaacctttggggaagcggccggcggt
                    ************************************************************

J9PBC4_MCL1-01      cctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgct
J9PBC4_MCL1-02      cctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgct
Q8HYS5_MCL1-01      cctgcctctgctggagctggtgggggaggccagcagtggccccggcatggacggctcgct
                    **************** *******************************************

J9PBC4_MCL1-01      accctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctgga
J9PBC4_MCL1-02      accctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctgga
Q8HYS5_MCL1-01      accctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctgga
                    ************************************************************

J9PBC4_MCL1-01      gattatctctcggtaccttcgggaacaggccacaggcgccaaggacgcgaaaccactggg
J9PBC4_MCL1-02      gattatctctcggtaccttcgggaacaggccacaggcgccaaggacgcgaaaccactggg
Q8HYS5_MCL1-01      gattatctctcggtaccttcgggaacaggccacaggcgccaaggacgcgaaaccactggg
                    ************************************************************

J9PBC4_MCL1-01      cgggtctcgggcggccagccggaaggcgttagagaccctccggcgagtcggggacggggt
J9PBC4_MCL1-02      cgggtctcgggcggccagccggaaggcgttagagaccctccggcgagtcggggacggggt
Q8HYS5_MCL1-01      cgggtctcgggcggccagccggaaggcgttagagaccctccagcgagtcggggacggggt
                    ***************************************** ******************

J9PBC4_MCL1-01      acagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacga
J9PBC4_MCL1-02      acagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacga
Q8HYS5_MCL1-01      acagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacga
                    ************************************************************

J9PBC4_MCL1-01      agacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaa
J9PBC4_MCL1-02      agacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaa
Q8HYS5_MCL1-01      agacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaa
                    ************************************************************

J9PBC4_MCL1-01      ctggggcaggattgtgactcttatttcctttggtgcctttgtggccaaacacttgaagag
J9PBC4_MCL1-02      ctggggcaggattgtgactcttatttcctttggtgcctttgtggccaaacacttgaagag
Q8HYS5_MCL1-01      ctggggcaggattgtgactcttatttcctttggtgcctttgtggccaaacacttgaagag
                    ************************************************************

J9PBC4_MCL1-01      tataaaccaagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaag
J9PBC4_MCL1-02      tataaaccaagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaag
Q8HYS5_MCL1-01      tataaaccaagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaag
                    ************************************************************

J9PBC4_MCL1-01      gacgaaacgagactggctagtcaaacaaagaggctgggatggaggggtgtggggggagtg
J9PBC4_MCL1-02      gacgaaacgagactggctagtcaaacaaagaggctgggatgg------gtttgtggagtt
Q8HYS5_MCL1-01      gacgaaacgagactggctagtcaaacaaagaggctgggatgg------gtttgtggagtt
                    ******************************************      **  * ***** 

J9PBC4_MCL1-01      gtccaccccctctgaccttaagggtgagagcaggaaggaatgctgcccttcctgggccgc
J9PBC4_MCL1-02      cttccatgtagaggacctagaaggtggcatcagaaatg--tgctgc--------------
Q8HYS5_MCL1-01      cttccatgtagaggacctagaaggcggcatcagaaatg--tgctgc--------------
                     * *         *****  * ** *  * *** ** *  ******              

J9PBC4_MCL1-01      tgaggctggaaggtggggggctgacctcagcctccagaccgtggctcagtggctcagtcc
J9PBC4_MCL1-02      -------------------------------------------------tggct------
Q8HYS5_MCL1-01      -------------------------------------------------tggct------
                                                                     *****      

J9PBC4_MCL1-01      cctcctgtcagcctgcaggaactcctcagctcctccctcctccccactagggattgttta
J9PBC4_MCL1-02      --------------------------------------------------------tttg
Q8HYS5_MCL1-01      --------------------------------------------------------tttg
                                                                            *** 

J9PBC4_MCL1-01      caggacagcttgggccacacagcacacgctcttcctgaagatgattctgatctggtttgc
J9PBC4_MCL1-02      cagg-------------------------tgttgctggag-----taggagctggttt--
Q8HYS5_MCL1-01      cagg-------------------------tgttgctggag-----taggagctggttt--
                    ****                         * ** *** **     *  ** *******  

J9PBC4_MCL1-01      cctcctccctcccagaggaccccgatggccgagggaggcatgggtgacaacatgtgggac
J9PBC4_MCL1-02      ------------------------------------------------------------
Q8HYS5_MCL1-01      ------------------------------------------------------------
                                                                                

J9PBC4_MCL1-01      acccactccaaggagtggaccagaagccccatgggagttcctttccctacctgccaccca
J9PBC4_MCL1-02      ------------------------------------------------------------
Q8HYS5_MCL1-01      ------------------------------------------------------------
                                                                                

J9PBC4_MCL1-01      gctctttctcccatttttaacgaagctccttctggaacactcaggcatctctgccggact
J9PBC4_MCL1-02      -------------------------------------------ggcatatcta-------
Q8HYS5_MCL1-01      -------------------------------------------ggcatatcta-------
                                                               ***** ***        

J9PBC4_MCL1-01      caaacactttgtagccaagagataa
J9PBC4_MCL1-02      ----------------ataagatag
Q8HYS5_MCL1-01      ----------------ataagatag
                                    *  ***** 

© 1998-2018