Dataset for CDS BCL-2-like of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


E2RS00_BCL2A1-01      atgacgg-------------------------------------------
Q76LT7_BCL2L1-01      atg---------------------tctcagag------------------
Q6R755_BCL2-01        atggcgc---------------aagccgggagaacagggtatga------
J9NXG3_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-02        atggcgc---------------acgctgggcgaacagggtacga------
Q75SV7_BCL2-01        atggcgc---------------acgctgggcgaacagggtacga------
Q45T69_BCL2L2-01      atggcgaccccagcctc-----agccccagacacacgggctcta------
J9PBC4_MCL1-01        atg-----ttcggcctcaagagaaacgcagtaat-cggactcaacctcta
J9PBC4_MCL1-02        atg-----ttcggcctcaagagaaacgcagtaat-cggactcaacctcta
Q8HYS5_MCL1-01        atg-----tttggcctcaagagaaacgcagtaatccggactcaa-ctcta
                                                                        

E2RS00_BCL2A1-01      --actgcgagtttg---------------gctacacgctggcgc------
Q76LT7_BCL2L1-01      caaccgggagctggtggttgactttctctcctacaagctttccc------
Q6R755_BCL2-01        taaccgggagatcgtgatgaagtacatacattataagctgtcac------
J9NXG3_BCL2-01        ----------------atgaagtacatccactacaagctgtcgc------
J9NXG3_BCL2-02        taaccgggagatagtgatgaagtacatccactacaagctgtcgc------
Q75SV7_BCL2-01        taaccgggagatagtgatgaagtacatccactacaagctgtcgc------
Q45T69_BCL2L2-01      --gtggcagact----ttgtag-------gctataagctgaggcagaagg
J9PBC4_MCL1-01        ctgtgggggggccgggctgggg-------gccggcagcggcggc----gc
J9PBC4_MCL1-02        ctgtgggggggccgggctgggg-------gccggcagcggcggc----gc
Q8HYS5_MCL1-01        ctgtgggggggccgggctgggg-------gccggcagcggcggc----gc
                                                          **     *      

E2RS00_BCL2A1-01      -------------------------------------tggcccaggacta
Q76LT7_BCL2L1-01      ----------------------------------agaaaggatacagctg
Q6R755_BCL2-01        ----------------------------------agaggggctacgagtg
J9NXG3_BCL2-01        ----------------------------------agaggggctacgagtg
J9NXG3_BCL2-02        ----------------------------------agaggggctacgagtg
Q75SV7_BCL2-01        ----------------------------------agaggggctacgagtg
Q45T69_BCL2L2-01      gttatgtttgtggagctggccct---------ggagagggcccagcagct
J9PBC4_MCL1-01        ctcctcttcgggagggcggcttttggcttcggggaaggaggccacgacca
J9PBC4_MCL1-02        ctcctcttcgggagggcggcttttggcttcggggaaggaggccacgacca
Q8HYS5_MCL1-01        ctcctcttcgggagggcggcttttggcttcggggagggaggccacgacca
                                                             *   *      

E2RS00_BCL2A1-01      c---------------------gtgaggcacgtcctg-------------
Q76LT7_BCL2L1-01      gagtcagtttagt--gatgtggaagagaacagaactgaggccccagaagg
Q6R755_BCL2-01        g--------------gatgtgggagatgtggacgccgcgcccctgggcg-
J9NXG3_BCL2-01        g--------------gacgcgggagaggcgggcgccgcgcccccggggg-
J9NXG3_BCL2-02        g--------------gacgcgggagaggcgggcgccgcgcccccggggg-
Q75SV7_BCL2-01        g--------------gacgcgggagaggcgggcgccgcgcccccggggg-
Q45T69_BCL2L2-01      gatccactgcaccaagccatgcgggcagctggagatgagtttg--agac-
J9PBC4_MCL1-01        g----acgggagggagggggaggggaagccggtgcggtgattggcggaa-
J9PBC4_MCL1-02        g----acgggagggagggggaggggaagccggtgcggtgattggcggaa-
Q8HYS5_MCL1-01        g----acgggagggagggggaggggaagccggtgcggtgattggcggaa-
                                              *           *             

E2RS00_BCL2A1-01      -----------------------cagatcccg-------cagcccggccc
Q76LT7_BCL2L1-01      gactgaatcagagatggagacccccagtgccatcaatggcaacccatcct
Q6R755_BCL2-01        -----------------------ccgcccccacccctggcatcttctcct
J9NXG3_BCL2-01        -----------------------ccgcccccgcgccgggcatctccgcct
J9NXG3_BCL2-02        -----------------------ccgcccccgcgccgggcatctccgcct
Q75SV7_BCL2-01        -----------------------ccgcccccgcgccgggcatcttctcct
Q45T69_BCL2L2-01      -----------------------ccgcttccg----gcgcaccttctctg
J9PBC4_MCL1-01        -----------------------gcg---ccg----gcgcaagtcccccg
J9PBC4_MCL1-02        -----------------------gcg---ccg----gcgcaagtcccccg
Q8HYS5_MCL1-01        -----------------------gcg---ccg----gcgcaagtcccccg
                                                   **        **      *  

E2RS00_BCL2A1-01      gg------------------------------------------------
Q76LT7_BCL2L1-01      gg------------------------------------------------
Q6R755_BCL2-01        tccagcctgagagcaacccaacgcccgctg---------tgcaccgggac
J9NXG3_BCL2-01        cgcagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        cgcagcccggccgcgcccccgcgcccgccaggacctcgccgcccccgccc
Q45T69_BCL2L2-01      atttggc-------------------------------------------
J9PBC4_MCL1-01        ac----c-------------------------------------------
J9PBC4_MCL1-02        ac----c-------------------------------------------
Q8HYS5_MCL1-01        ac----c-------------------------------------------
                                                                        

E2RS00_BCL2A1-01      --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
Q6R755_BCL2-01        atggctgccaggacatcgccactaaggcccatagtcgccaccactgggcc
J9NXG3_BCL2-01        nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn----------------
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        cccgccgcccccgctgccgccgccgccgccgccgccgacgccgcgggccc
Q45T69_BCL2L2-01      --------------------------------------------------
J9PBC4_MCL1-01        --------------------------------------------------
J9PBC4_MCL1-02        --------------------------------------------------
Q8HYS5_MCL1-01        --------------------------------------------------
                                                                        

E2RS00_BCL2A1-01      --cccccagc--------agagcgtccagggtgctccaggacgtggcctt
Q76LT7_BCL2L1-01      --cacttggcagacagccctgcggtgaatggagccactggccacagcagc
Q6R755_BCL2-01        tacccttagc-----cccgtgccacctgtggtcc-acctgac----cctc
J9NXG3_BCL2-01        --nnnncagc-----cccgtgccacctgtggtcc-acctgac----cctg
J9NXG3_BCL2-02        --cgcncagc-----cccgtgccacctgtggtcc-acctgac----cctg
Q75SV7_BCL2-01        cgcgcccagc-----cccgtgccacctgtggtcc-acctgac----cctg
Q45T69_BCL2L2-01      --agcccagc-----tgcatgtgaccccaggctcagcccagcaacgcttc
J9PBC4_MCL1-01        --actctggc-----gccggacgcccggagggtc-gcgcggc----cctc
J9PBC4_MCL1-02        --actctggc-----gccggacgcccggagggtc-gcgcggc----cctc
Q8HYS5_MCL1-01        --actctggc-----gccggacgcccggagggtc-gcgcggc----cctc
                              **                   **  *  *    *    *   

E2RS00_BCL2A1-01      ctccgtccaggggcaggtggaaaaga------------acctgaagccg-
Q76LT7_BCL2L1-01      agct-------tggatgcccgggagg------tgatccccatggcagcgg
Q6R755_BCL2-01        cgcc----------gggctggggatg--------acttctcc-----cgt
J9NXG3_BCL2-01        cgcc----------aggccggcgacg--------acttctcc-----cgc
J9NXG3_BCL2-02        cgcc----------aggccggcgacg--------acttctcc-----cgc
Q75SV7_BCL2-01        cgcc----------aggccggcgacg--------acttctcc-----cgc
Q45T69_BCL2L2-01      accc----------aggtctctgacg-------aactcttccaagggggc
J9PBC4_MCL1-01        acccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgc
J9PBC4_MCL1-02        acccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgc
Q8HYS5_MCL1-01        acccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgc
                        *             *      *                        * 

E2RS00_BCL2A1-01      ---tgcttggacagt-----------------tttgacgtggtgt-ctgt
Q76LT7_BCL2L1-01      tgaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccgg
Q6R755_BCL2-01        cgctaccgtcgcgac-----------------ttcgcggagatgtccagt
J9NXG3_BCL2-01        cgctaccggcg---t-----------------ttcgccgagatgtccagc
J9NXG3_BCL2-02        cgctaccggcg---t-----------------ttcgccgagatgtccagc
Q75SV7_BCL2-01        cgctaccgccgcgac-----------------ttcgccgagatgtccagc
Q45T69_BCL2L2-01      cccaactggggccgt-----------------cttgtggc-cttctttgt
J9PBC4_MCL1-01        tgctgctcgcgcccc-----------------cctgccgcgcgtcgccgc
J9PBC4_MCL1-02        tgctgctcgcgcccc-----------------cctgccgcgcgtcgccgc
Q8HYS5_MCL1-01        tgctgctcgcgcccc-----------------cctgccgcgcgtcgccgc
                           *                             *            * 

E2RS00_BCL2A1-01      c-------------------gacacggccagaaccatattcaatcaggtg
Q76LT7_BCL2L1-01      c---gggcattcagtgacctgacatc-ccagcttcacatcaccccaggga
Q6R755_BCL2-01        c-----agctgca----cctgacgcc-----cttca----ccgcgagggg
J9NXG3_BCL2-01        c-----agctgca----cctgacgcc-----cttca----ccgcgagggg
J9NXG3_BCL2-02        c-----agctgca----cctgacgcc-----cttca----ccgcgagggg
Q75SV7_BCL2-01        c-----agctgca----cctgacgcc-----cttca----ccgcgagggg
Q45T69_BCL2L2-01      ctttggagctgca----ctgtgtgctgagagtgtca------acaaagag
J9PBC4_MCL1-01        ctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagag
J9PBC4_MCL1-02        ctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagag
Q8HYS5_MCL1-01        ctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagag
                      *                                 **         * *  

E2RS00_BCL2A1-01      a---------------------------tggagaagg-------------
Q76LT7_BCL2L1-01      cagcatatcagagctttgag----caggtagtgaatg-------------
Q6R755_BCL2-01        acgct----------ttgcc----acggtggtggagg-------------
J9NXG3_BCL2-01        acgct----------ttgcc----acggtggtggagg-------------
J9NXG3_BCL2-02        acgct----------ttgcc----acggtggtggagg-------------
Q75SV7_BCL2-01        acgct----------ttgcc----acggtggtggagg-------------
Q45T69_BCL2L2-01      atg------------gagcc---acttgtgggacaag-------------
J9PBC4_MCL1-01        gagctagacgggtacgagccggaacctttgggg-aagcggccggcggtcc
J9PBC4_MCL1-02        gagctagacgggtacgagccggaacctttgggg-aagcggccggcggtcc
Q8HYS5_MCL1-01        gagctagacgggtacgagccggaacctttgggg-aagcggccggcggtcc
                                                  * *   * *             

E2RS00_BCL2A1-01      -aatttgaagacggcgtcattaactggggaaggatc---gtgaccgtttt
Q76LT7_BCL2L1-01      -aactcttccgggatggggtgaactggggtcgcatt---gtggccttttt
Q6R755_BCL2-01        -agctcttcagggatggggtgaactgggggaggatc---gtggccttctt
J9NXG3_BCL2-01        -agctcttcagggatggggtgaactgggggaggatc---gtggccttctt
J9NXG3_BCL2-02        -agctcttcagggatggggtgaactgggggaggatc---gtggccttctt
Q75SV7_BCL2-01        -agctcttcagggatggggtgaactgggggaggatt---gtggccttctt
Q45T69_BCL2L2-01      ------tgcaagagtgga------tg-------------gtggcctacct
J9PBC4_MCL1-01        tgcctctgctggagttgg------tgggggaggccagcagtggcc--ccg
J9PBC4_MCL1-02        tgcctctgctggagttgg------tgggggaggccagcagtggcc--ccg
Q8HYS5_MCL1-01        tgcctctgctggagctgg------tgggggaggccagcagtggcc--ccg
                                              **             *** **     

E2RS00_BCL2A1-01      ---------------tgcctttgaaggaattctcaccaagaaactcctcg
Q76LT7_BCL2L1-01      ---------------ctccttcggtggggcactgtgcgtggagagcgtag
Q6R755_BCL2-01        tgag---------------ttcggtggggtcatgtgtgtggagagcgtca
J9NXG3_BCL2-01        tgag---------------ttcggtggggtcatgtgtgtggagagcgtca
J9NXG3_BCL2-02        tgag---------------ttcggtggggtcatgtgtgtggagagcgtca
Q75SV7_BCL2-01        tgag---------------ttcggtggggtcatgtgtgtggagagcgtca
Q45T69_BCL2L2-01      ggagacacggctggc------cgactggatccacagcagtgggggctggg
J9PBC4_MCL1-01        gcatggacggctcgctaccctcgacgccacccccggcggaggaggaggaa
J9PBC4_MCL1-02        gcatggacggctcgctaccctcgacgccacccccggcggaggaggaggaa
Q8HYS5_MCL1-01        gcatggacggctcgctaccctcgacgccacccccggcggaggaggaggaa
                                            *                           

E2RS00_BCL2A1-01      agcagcgaatttcctcggatgtggatgccgagaaggtttcctactt----
Q76LT7_BCL2L1-01      acaaggagatg---caggtattgg-tg--agtcggatcgcagcttg----
Q6R755_BCL2-01        accgggagatg---tcgcccctgg-tg--gacaacatcgccctgtg----
J9NXG3_BCL2-01        accgggagatg---tcgcccctgg-tg--gacaacatcgccctgtg----
J9NXG3_BCL2-02        accgggagatg---tcgcccctgg-tg--gacaacatcgccctgtg----
Q75SV7_BCL2-01        accgggagatg---tcgcccctgg-tg--gacaacatcgccctgtg----
Q45T69_BCL2L2-01      -------------------------cg--gagttcacagctctata----
J9PBC4_MCL1-01        gatgagttgta---ccggcagtccctg--gagattatctctcggtacctt
J9PBC4_MCL1-02        gatgagttgta---ccggcagtccctg--gagattatctctcggtacctt
Q8HYS5_MCL1-01        gatgagttgta---ccggcagtccctg--gagattatctctcggtacctt
                                                *            *    *     

E2RS00_BCL2A1-01      -cgtggcagagttcatcacg------------------------------
Q76LT7_BCL2L1-01      -gatggccacttacctgaat------------------------------
Q6R755_BCL2-01        -gatgactgagtacctgaac------------------------------
J9NXG3_BCL2-01        -gatgactgagtacctgaac------------------------------
J9NXG3_BCL2-02        -gatgactgagtacctgaac------------------------------
Q75SV7_BCL2-01        -gatgactgagtacctgaac------------------------------
Q45T69_BCL2L2-01      cggggacggggccctgg-----aggaggcg--------------------
J9PBC4_MCL1-01        cgggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcg
J9PBC4_MCL1-02        cgggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcg
Q8HYS5_MCL1-01        cgggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcg
                            *      *                                    

E2RS00_BCL2A1-01      -------------------------------agaaacatgagagactgga
Q76LT7_BCL2L1-01      -------------------------------gaccacctagagccttgga
Q6R755_BCL2-01        -------------------------------cggcatctgcacacctgga
J9NXG3_BCL2-01        -------------------------------cggcatctgcacacctgga
J9NXG3_BCL2-02        -------------------------------cggcatctgcacacctgga
Q75SV7_BCL2-01        -------------------------------cggcatctgcacacctgga
Q45T69_BCL2L2-01      -------------------------------cggcgtctgcgggagggg-
J9PBC4_MCL1-01        ggcggccagccggaaggcgttagagaccctccggcgagtcggggacgggg
J9PBC4_MCL1-02        ggcggccagccggaaggcgttagagaccctccggcgagtcggggacgggg
Q8HYS5_MCL1-01        ggcggccagccggaaggcgttagagaccctccagcgagtcggggacgggg
                                                            *        ** 

E2RS00_BCL2A1-01      taagacaaaacggagg---------ctgggaaaacggctttgtgaagaag
Q76LT7_BCL2L1-01      tccaggagaacggcgg---------ctggg---atacttttgtggaactc
Q6R755_BCL2-01        tccaggacaacggagg---------ctggg---atgcctttgtggaactg
J9NXG3_BCL2-01        tccaggacaacggagg---------ctggg---atgcctttgtggaactg
J9NXG3_BCL2-02        tccaggacaacggagg---------ctgg---------------------
Q75SV7_BCL2-01        tccaggacaacggagg---------ctggg---atgcctttgtggaactg
Q45T69_BCL2L2-01      ---------------------------------------------aactg
J9PBC4_MCL1-01        tacagcgcaaccacgagacagccttccaag---gcatgcttcggaaactg
J9PBC4_MCL1-02        tacagcgcaaccacgagacagccttccaag---gcatgcttcggaaactg
Q8HYS5_MCL1-01        tacagcgcaaccacgagacagccttccaag---gcatgcttcggaaactg
                                                                        

E2RS00_BCL2A1-01      ttcgaacccaagtctggatggctga-------------------------
Q76LT7_BCL2L1-01      tac--gggaacaatgcagcagccgagagccggaagggccaggagcgcttc
Q6R755_BCL2-01        tacggccccaccatgcagcctctgtttgat-----------------ttc
J9NXG3_BCL2-01        tacggccccaccatgcagcctctgtttgac-----------------ttc
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        tacggccccaccatgcagcctctgtttgac-----------------ttc
Q45T69_BCL2L2-01      ggc--ctc---agtgaggacagtgc-------------------------
J9PBC4_MCL1-01        gac--atcaaaaacgaagacgatgtcaaatcg--ttgtctcgagtgattg
J9PBC4_MCL1-02        gac--atcaaaaacgaagacgatgtcaaatcg--ttgtctcgagtgattg
Q8HYS5_MCL1-01        gac--atcaaaaacgaagacgatgtcaaatcg--ttgtctcgagtgattg
                                                                        

E2RS00_BCL2A1-01      -------cttttctggaagttctg-------ggaacagtgtgtgaaatgt
Q76LT7_BCL2L1-01      aaccgctggttcctgaca---------------ggcatgactgtggctgg
Q6R755_BCL2-01        tcctggctgtctctgaaggcgctgctcagtctggccctggtgggagcttg
J9NXG3_BCL2-01        tcctggctgtctctgaaggcgctgctcagtctggccctggtgggagcttg
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        tcctggctgtctctgaaggcgctgctcagtctggccctggtgggagcttg
Q45T69_BCL2L2-01      -------------tgacgggg-------gccgtggca--ctgggggccct
J9PBC4_MCL1-01        tccatgttttcagtgacggag-taacaaactggggcaggattgtgactct
J9PBC4_MCL1-02        tccatgttttcagtgacggag-taacaaactggggcaggattgtgactct
Q8HYS5_MCL1-01        tccatgttttcagtgacggag-taacaaactggggcaggattgtgactct
                                                                        

E2RS00_BCL2A1-01      ggtcacacctaaagcaatact-----------------------------
Q76LT7_BCL2L1-01      cgtggttctgctgggctcgctcttcagtcg--------------------
Q6R755_BCL2-01        catcaccctgggtgcctatctgggcca-----------------------
J9NXG3_BCL2-01        catcaccctgggtgcctatctgggcca-----------------------
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        catcaccctgggtgcctatctgggcca-----------------------
Q45T69_BCL2L2-01      ggtcaccgtaggggccttt-------------------------------
J9PBC4_MCL1-01        tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaag
J9PBC4_MCL1-02        tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaag
Q8HYS5_MCL1-01        tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaag
                                                                        

E2RS00_BCL2A1-01      --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
Q6R755_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
Q45T69_BCL2L2-01      --------------------------------------------------
J9PBC4_MCL1-01        aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
J9PBC4_MCL1-02        aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
Q8HYS5_MCL1-01        aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
                                                                        

E2RS00_BCL2A1-01      --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
Q6R755_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
Q45T69_BCL2L2-01      --------------------------------------------------
J9PBC4_MCL1-01        acgaaacgagactggctagtcaaacaaagaggctgggatggaggggtgtg
J9PBC4_MCL1-02        acgaaacgagactggctagtcaaacaaagaggctgggatgg------gtt
Q8HYS5_MCL1-01        acgaaacgagactggctagtcaaacaaagaggctgggatgg------gtt
                                                                        

E2RS00_BCL2A1-01      --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
Q6R755_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
Q45T69_BCL2L2-01      --------------------------------------------------
J9PBC4_MCL1-01        gggggagtggtccaccccctctgaccttaagggtgagagcaggaaggaat
J9PBC4_MCL1-02        tgtggagttcttccatgtagaggacctagaaggtggcatcagaaatg--t
Q8HYS5_MCL1-01        tgtggagttcttccatgtagaggacctagaaggcggcatcagaaatg--t
                                                                        

E2RS00_BCL2A1-01      --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
Q6R755_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
Q45T69_BCL2L2-01      --------------------------------------------------
J9PBC4_MCL1-01        gctgcccttcctgggccgctgaggctggaaggtggggggctgacctcagc
J9PBC4_MCL1-02        gctgc---------------------------------------------
Q8HYS5_MCL1-01        gctgc---------------------------------------------
                                                                        

E2RS00_BCL2A1-01      --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
Q6R755_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
Q45T69_BCL2L2-01      --------------------------------------------------
J9PBC4_MCL1-01        ctccagaccgtggctcagtggctcagtcccctcctgtcagcctgcaggaa
J9PBC4_MCL1-02        ------------------tggct---------------------------
Q8HYS5_MCL1-01        ------------------tggct---------------------------
                                                                        

E2RS00_BCL2A1-01      --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
Q6R755_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
Q45T69_BCL2L2-01      -----------------------------------tttgcgag-------
J9PBC4_MCL1-01        ctcctcagctcctccctcctccccactagggattgtttacaggacagctt
J9PBC4_MCL1-02        -----------------------------------tttgcagg-------
Q8HYS5_MCL1-01        -----------------------------------tttgcagg-------
                                                                        

E2RS00_BCL2A1-01      --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
Q6R755_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
Q45T69_BCL2L2-01      --------------------------------------------------
J9PBC4_MCL1-01        gggccacacagcacacgctcttcctgaagatgattctgatctggtttgcc
J9PBC4_MCL1-02        ------------------tgttgctggag-----taggagctggttt---
Q8HYS5_MCL1-01        ------------------tgttgctggag-----taggagctggttt---
                                                                        

E2RS00_BCL2A1-01      --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
Q6R755_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
Q45T69_BCL2L2-01      --------------------------------------------------
J9PBC4_MCL1-01        ctcctccctcccagaggaccccgatggccgagggaggcatgggtgacaac
J9PBC4_MCL1-02        --------------------------------------------------
Q8HYS5_MCL1-01        --------------------------------------------------
                                                                        

E2RS00_BCL2A1-01      --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
Q6R755_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
Q45T69_BCL2L2-01      --------------------------------------------------
J9PBC4_MCL1-01        atgtgggacacccactccaaggagtggaccagaagccccatgggagttcc
J9PBC4_MCL1-02        --------------------------------------------------
Q8HYS5_MCL1-01        --------------------------------------------------
                                                                        

E2RS00_BCL2A1-01      --------------------------------------------------
Q76LT7_BCL2L1-01      --------------------------------------------------
Q6R755_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-01        --------------------------------------------------
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        --------------------------------------------------
Q45T69_BCL2L2-01      --------------------------------------------------
J9PBC4_MCL1-01        tttccctacctgccacccagctctttctcccatttttaacgaagctcctt
J9PBC4_MCL1-02        --------------------------------------------------
Q8HYS5_MCL1-01        --------------------------------------------------
                                                                        

E2RS00_BCL2A1-01      -------------------------------------------------a
Q76LT7_BCL2L1-01      -----------------------------------------------gaa
Q6R755_BCL2-01        -----------------------------------------------taa
J9NXG3_BCL2-01        -----------------------------------------------taa
J9NXG3_BCL2-02        --------------------------------------------------
Q75SV7_BCL2-01        -----------------------------------------------taa
Q45T69_BCL2L2-01      -----------------------------------------------caa
J9PBC4_MCL1-01        ctggaacactcaggcatctctgccggactcaaacactttgtagccaagag
J9PBC4_MCL1-02        ------------ggcatatcta-----------------------ataag
Q8HYS5_MCL1-01        ------------ggcatatcta-----------------------ataag
                                                                        

E2RS00_BCL2A1-01      ctga
Q76LT7_BCL2L1-01      atga
Q6R755_BCL2-01        gtga
J9NXG3_BCL2-01        gtga
J9NXG3_BCL2-02        ----
Q75SV7_BCL2-01        gtga
Q45T69_BCL2L2-01      gtga
J9PBC4_MCL1-01        ataa
J9PBC4_MCL1-02        atag
Q8HYS5_MCL1-01        atag
                          

© 1998-2018