Dataset for CDS BCL-2 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q6R755_BCL2-01      atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacat
J9NXG3_BCL2-01      ---------------------------------------------atgaagtacatccac
J9NXG3_BCL2-02      atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccac
Q75SV7_BCL2-01      atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccac
                                                                 *********** ** 

Q6R755_BCL2-01      tataagctgtcacagaggggctacgagtgggatgtgggagatgtggacgccgcgcccctg
J9NXG3_BCL2-01      tacaagctgtcgcagaggggctacgagtgggacgcgggagaggcgggcgccgcgcccccg
J9NXG3_BCL2-02      tacaagctgtcgcagaggggctacgagtgggacgcgggagaggcgggcgccgcgcccccg
Q75SV7_BCL2-01      tacaagctgtcgcagaggggctacgagtgggacgcgggagaggcgggcgccgcgcccccg
                    ** ******** ******************** * ****** * ** *********** *

Q6R755_BCL2-01      ggcgccgcccccacccctggcatcttctccttccagcctgagagcaacccaacgcccgct
J9NXG3_BCL2-01      ggggccgcccccgcgccgggcatctccgcctcgcagnnnnnnnnnnnnnnnnnnnnnnnn
J9NXG3_BCL2-02      ggggccgcccccgcgccgggcatctccgcct-----------------------------
Q75SV7_BCL2-01      ggggccgcccccgcgccgggcatcttctcctcgcagcccggccgcgcccccgcgcccgcc
                    ** ********* * ** ******* * ***                             

Q6R755_BCL2-01      g---------tgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgcc
J9NXG3_BCL2-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn-----
J9NXG3_BCL2-02      ------------------------------------------------------------
Q75SV7_BCL2-01      aggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgac
                                                                                

Q6R755_BCL2-01      accactgggcctacccttagccccgtgccacctgtggtccacctgaccctccgccgggct
J9NXG3_BCL2-01      -------------nnnncagccccgtgccacctgtggtccacctgaccctgcgccaggcc
J9NXG3_BCL2-02      -------------cgcncagccccgtgccacctgtggtccacctgaccctgcgccaggcc
Q75SV7_BCL2-01      gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggcc
                                      ******************************** **** *** 

Q6R755_BCL2-01      ggggatgacttctcccgtcgctaccgtcgcgacttcgcggagatgtccagtcagctgcac
J9NXG3_BCL2-01      ggcgacgacttctcccgccgctaccggcg---tttcgccgagatgtccagccagctgcac
J9NXG3_BCL2-02      ggcgacgacttctcccgccgctaccggcg---tttcgccgagatgtccagccagctgcac
Q75SV7_BCL2-01      ggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcac
                    ** ** *********** ******** **    ***** *********** *********

Q6R755_BCL2-01      ctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggat
J9NXG3_BCL2-01      ctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggat
J9NXG3_BCL2-02      ctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggat
Q75SV7_BCL2-01      ctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggat
                    ************************************************************

Q6R755_BCL2-01      ggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
J9NXG3_BCL2-01      ggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
J9NXG3_BCL2-02      ggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
Q75SV7_BCL2-01      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
                    ******************** ***************************************

Q6R755_BCL2-01      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
J9NXG3_BCL2-01      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
J9NXG3_BCL2-02      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
Q75SV7_BCL2-01      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtac
                    ************************************************************

Q6R755_BCL2-01      ctgaaccggcatctgcacacctggatccaggacaacggaggctgggatgcctttgtggaa
J9NXG3_BCL2-01      ctgaaccggcatctgcacacctggatccaggacaacggaggctgggatgcctttgtggaa
J9NXG3_BCL2-02      ctgaaccggcatctgcacacctggatccaggacaacggaggctgg---------------
Q75SV7_BCL2-01      ctgaaccggcatctgcacacctggatccaggacaacggaggctgggatgcctttgtggaa
                    *********************************************               

Q6R755_BCL2-01      ctgtacggccccaccatgcagcctctgtttgatttctcctggctgtctctgaaggcgctg
J9NXG3_BCL2-01      ctgtacggccccaccatgcagcctctgtttgacttctcctggctgtctctgaaggcgctg
J9NXG3_BCL2-02      ------------------------------------------------------------
Q75SV7_BCL2-01      ctgtacggccccaccatgcagcctctgtttgacttctcctggctgtctctgaaggcgctg
                                                                                

Q6R755_BCL2-01      ctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
J9NXG3_BCL2-01      ctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
J9NXG3_BCL2-02      ------------------------------------------------------------
Q75SV7_BCL2-01      ctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
                                                                                

© 1998-2018