Dataset for CDS MCL-1 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F7GTF7_MCL1-01      atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
F7GTF7_MCL1-02      atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
F7GTF7_MCL1-03      atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc

F7GTF7_MCL1-01      ttgggggccggcagcggcggcgccacccctccgggagggcggcttttggccacagagaag
F7GTF7_MCL1-02      ttgggggccggcagcggcggcgccacccctccgggagggcggcttttggccacagagaag
F7GTF7_MCL1-03      ttgggggccggcagcggcggcgccacccctccgggagggcggctttt-------------

F7GTF7_MCL1-01      gaggcctcggcccagcgagaggtagggggaggggaggccggcgcggtgactggcggaagc
F7GTF7_MCL1-02      gaggcctcggcccagcgagaggtagggggaggggaggccggcgcggtgactggcggaagc
F7GTF7_MCL1-03      ------------------------------------------------------------

F7GTF7_MCL1-01      gccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcgtgcggccgccg
F7GTF7_MCL1-02      gccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcgtgcggccgccg
F7GTF7_MCL1-03      ------------------------------------------------------------

F7GTF7_MCL1-01      cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcg
F7GTF7_MCL1-02      cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcg
F7GTF7_MCL1-03      ------------------------------------------------------------

F7GTF7_MCL1-01      cccacccgccgcgcggcgccgctggaggagatggaagccccggccgccgacgccatcatg
F7GTF7_MCL1-02      cccacccgccgcgcggcgccgctggaggagatggaagccccggccgccgacgccatcatg
F7GTF7_MCL1-03      ------------------------------------------------------------

F7GTF7_MCL1-01      tcgccggaagaagagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
F7GTF7_MCL1-02      tcgccggaagaagagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
F7GTF7_MCL1-03      ------------------------------------------------------------

F7GTF7_MCL1-01      ctgcctctgctggagttggtcggggagcctgctaatggctccagtacggacgggtcacta
F7GTF7_MCL1-02      ctgcctctgctggagttggtcggggagcctgctaatggctccagtacggacgggtcacta
F7GTF7_MCL1-03      ------------------------------------------------------------

F7GTF7_MCL1-01      ccgtcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
F7GTF7_MCL1-02      ccgtcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
F7GTF7_MCL1-03      ------------------------------------------------------------

F7GTF7_MCL1-01      attatctctcggtaccttcgggagcaggcgaccggcgccaaggacacaaagccaatgggc
F7GTF7_MCL1-02      attatctctcggtaccttcgggagcaggcgaccggcgccaaggacacaaagccaatgggc
F7GTF7_MCL1-03      --------------------------ggcgaccggcgccaaggacacaaagccaatgggc

F7GTF7_MCL1-01      aggtccggggccgccagcaggaaggcgctggagaccttacgacgggttggggacggcgtg
F7GTF7_MCL1-02      aggtccggggccgccagcaggaaggcgctggagaccttacgacgggttggggacggcgtg
F7GTF7_MCL1-03      aggtccggggccgccagcaggaaggcgctggagaccttacgacgggttggggacggcgtg

F7GTF7_MCL1-01      cagcgcaaccacgagacggccttccaa---------------------------------
F7GTF7_MCL1-02      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
F7GTF7_MCL1-03      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa

F7GTF7_MCL1-01      ------------------------------------------------------------
F7GTF7_MCL1-02      gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaac
F7GTF7_MCL1-03      gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaac

F7GTF7_MCL1-01      ------------------------------------------------------------
F7GTF7_MCL1-02      tggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagacc
F7GTF7_MCL1-03      tggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagacc

F7GTF7_MCL1-01      ------------------------------------------------------------
F7GTF7_MCL1-02      ataaaccaagaaagctgcattgaaccattagcagaaagtatcacagacgttctcgtaagg
F7GTF7_MCL1-03      ataaaccaagaaagctgcattgaaccattagcagaaagtatcacagacgttctcgtaagg

F7GTF7_MCL1-01      -----------------------------------ggatgggtttgtggagttcttccat
F7GTF7_MCL1-02      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
F7GTF7_MCL1-03      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat

F7GTF7_MCL1-01      gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctgga
F7GTF7_MCL1-02      gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctgga
F7GTF7_MCL1-03      gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctgga

F7GTF7_MCL1-01      gtaggagctgggttggcatatctaataagatagccttggaa
F7GTF7_MCL1-02      gtaggagctgggttggcatatctaataagatag--------
F7GTF7_MCL1-03      gtaggagctgggttggcatatctaataagatag--------

© 1998-2019