Dataset for CDS BCL-2-like of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      cttctggttctctgtccatatattaatgccagtctttcatccttgcctct
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        ---------atgacagactctgaatttggatatattcacaatctaactca
U3DBA0_BCL2A1-01        ---------atgacagactctgaatttggatatattcacaatctaactca
F7IT34_BCL2L1-02        ------------------------------------------atgtctca
F7IT34_BCL2L1-01        ------------------------------------------atgtctca
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      tatagctgcccggatggc-------------gaccccagcctccgcccca
A0A2R8M4C0_BCL2L2-      -------------atggc-------------gaccccagcctccgcccca
A0A2R8MY14_BCL2-01      ---------atggc--gc-------------acgctgggagaacagggta
F7CT87_BCL2L10-01       ---------atggctgac-------------ccgctgcggcagc-----g
F7GTF7_MCL1-01          ---------atgtttggc-------------ct-ccaaagaaac-----g
F7GTF7_MCL1-02          ---------atgtttggc-------------ct-ccaaagaaac-----g
F7GTF7_MCL1-03          ---------atgtttggc-------------ct-ccaaagaaac-----g
                                                                          

U3DBA0_BCL2A1-02        ggactatctgcagtacgtcctgcagataccacagtctggaatgggtccga
U3DBA0_BCL2A1-01        ggactatctgcagtacgtcctgcagataccacagtctggaatgggtccga
F7IT34_BCL2L1-02        gagcaaccgggagctggtggttgactttctctcctacaagctttcccaga
F7IT34_BCL2L1-01        gagcaaccgggagctggtggttgactttctctcctacaagctttcccaga
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      ga-cacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2R8M4C0_BCL2L2-      ga-cacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2R8MY14_BCL2-01      cgataaccgggagatagtgatgaagtacatccactataagctgtcgcaga
F7CT87_BCL2L10-01       caccgagcag------------------------------ctgg---tga
F7GTF7_MCL1-01          cggtaatcgg------------------actcaacctctactgt---ggg
F7GTF7_MCL1-02          cggtaatcgg------------------actcaacctctactgt---ggg
F7GTF7_MCL1-03          cggtaatcgg------------------actcaacctctactgt---ggg
                                                                          

U3DBA0_BCL2A1-02        gcaaa-acgtctagag------------tgctacaacaggttgcattctc
U3DBA0_BCL2A1-01        gcaaa-acgtctagag------------tgctacaacaggttgcattctc
F7IT34_BCL2L1-02        aaggatacagctggagtcagtttagtgatgtggaagagaacaggactgag
F7IT34_BCL2L1-01        aaggatacagctggagtcagtttagtgatgtggaagagaacaggactgag
F7IT34_BCL2L1-03        ---------------------------atgtggaagagaacaggactgag
A0A2R8M4C0_BCL2L2-      aaggttatgtc-----------------tgtgga----------act--g
A0A2R8M4C0_BCL2L2-      aaggttatgtc-----------------tgtgga----------act--g
A0A2R8MY14_BCL2-01      ggggctacgagtggga------------tgccggagatgtgggcgccgcg
F7CT87_BCL2L10-01       cggactac--ctggag------------tactgctcccgggagcctggca
F7GTF7_MCL1-01          ggggccgg--cttggg------------ggccggcagcggcggcgccacc
F7GTF7_MCL1-02          ggggccgg--cttggg------------ggccggcagcggcggcgccacc
F7GTF7_MCL1-03          ggggccgg--cttggg------------ggccggcagcggcggcgccacc
                                                                          

U3DBA0_BCL2A1-02        agtcca--------------aaaagaagt---------------------
U3DBA0_BCL2A1-01        agtcca--------------aaaagaagt---------------------
F7IT34_BCL2L1-02        gcccca--------------gaagggactgattcggagatgg--------
F7IT34_BCL2L1-01        gcccca--------------gaagggactgattcggagatgg--------
F7IT34_BCL2L1-03        gcccca--------------gaagggactgattcggagatgg--------
A0A2R8M4C0_BCL2L2-      gccccg--------------gggagggccca---gcagct----------
A0A2R8M4C0_BCL2L2-      gccccg--------------gggagggccca---gcagct----------
A0A2R8MY14_BCL2-01      cccccaggggccgcccccgcggagggcatcttctcttcccagcccgggca
F7CT87_BCL2L10-01       cccccg--------------agtcgccgccgtccaccgcc----------
F7GTF7_MCL1-01          cctccg--------------ggagggcggcttttggccacagagaaggag
F7GTF7_MCL1-02          cctccg--------------ggagggcggcttttggccacagagaaggag
F7GTF7_MCL1-03          cctccg--------------ggagggcggctttt----------------
                           **                   *                         

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        ------------------------------agacccccag----------
F7IT34_BCL2L1-01        ------------------------------agacccccag----------
F7IT34_BCL2L1-03        ------------------------------agacccccag----------
A0A2R8M4C0_BCL2L2-      -------------------------------gacccgctg----------
A0A2R8M4C0_BCL2L2-      -------------------------------gacccgctg----------
A0A2R8MY14_BCL2-01      cacgccc-----------------------ggtcccgccgcgccccggga
F7CT87_BCL2L10-01       ------------------------------gaggccgctgtgctgcgcgc
F7GTF7_MCL1-01          gcctcggcccagcgagaggtagggggaggggaggccggcgcggtgactgg
F7GTF7_MCL1-02          gcctcggcccagcgagaggtagggggaggggaggccggcgcggtgactgg
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        ------tgccatcaatggcaacccatcctggcacctggcggacagcccag
F7IT34_BCL2L1-01        ------tgccatcaatggcaacccatcctggcacctggcggacagcccag
F7IT34_BCL2L1-03        ------tgccatcaatggcaacccatcctggcacctggcggacagcccag
A0A2R8M4C0_BCL2L2-      ------cacca-----agcaat---------------gcgggcagct---
A0A2R8M4C0_BCL2L2-      ------cacca-----agcaat---------------gcgggcagct---
A0A2R8MY14_BCL2-01      cccggtcgccag--------------------------------------
F7CT87_BCL2L10-01       cgtggccgccagtgtg----------------------cggaaactctac
F7GTF7_MCL1-01          cggaagcgccggcgctagccccccggccgccctcacgcctgacgcccgaa
F7GTF7_MCL1-02          cggaagcgccggcgctagccccccggccgccctcacgcctgacgcccgaa
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        tggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
F7IT34_BCL2L1-01        tggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
F7IT34_BCL2L1-03        t-------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8MY14_BCL2-01      -gacctcgccgccgccgccc------------ccagccgcccccgccgcc
F7CT87_BCL2L10-01       cggtctttcttct-ccgcct------------------------acctcg
F7GTF7_MCL1-01          gggtcgtgcggccgccgcccattggcgccgaggtccccgacgtcaccgcg
F7GTF7_MCL1-02          gggtcgtgcggccgccgcccattggcgccgaggtccccgacgtcaccgcg
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        atccccatggca--------------------------------------
F7IT34_BCL2L1-01        atccccatggca--------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8MY14_BCL2-01      gccgccacgggg---------------cctacgctcagcccggtgccacc
F7CT87_BCL2L10-01       gctaccccggga----------------------accgcgtcgagctggt
F7GTF7_MCL1-01          accccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgct
F7GTF7_MCL1-02          accccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgccgct
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        ----------------------------ggaaaagagtctgaagtc----
U3DBA0_BCL2A1-01        ----------------------------ggaaaagagtctgaagtc----
F7IT34_BCL2L1-02        -gcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggt
F7IT34_BCL2L1-01        -gcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggt
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      ----------------------------ggagatgaattcgagacccgct
A0A2R8M4C0_BCL2L2-      ----------------------------ggagatgaattcgagacccgct
A0A2R8MY14_BCL2-01      tgtggtccacctgaccctccgccaggccggcgacgacttctcccgccgct
F7CT87_BCL2L10-01       ggcg-------------------aggatggcggaggccctgctctccgac
F7GTF7_MCL1-01          ggag-------------------gagat---ggaagccccggccgccgac
F7GTF7_MCL1-02          ggag-------------------gagat---ggaagccccggccgccgac
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        --------------------atgcttggacaatgttgatattgcgtccat
U3DBA0_BCL2A1-01        --------------------atgcttggacaatgttgatattgcgtccat
F7IT34_BCL2L1-02        accggcgggcatttagtgacctgacatcccagc--tccacatcacccccg
F7IT34_BCL2L1-01        accggcgggcatttagtgacctgacatcccagc--tccacatcacccccg
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      tccggcgcaccttctctgatctggcggctcagc--tgcatgtgaccccag
A0A2R8M4C0_BCL2L2-      tccggcgcaccttctctgatctggcggctcagc--tgcatgtgaccccag
A0A2R8MY14_BCL2-01      accgccgcgacttcgccgagatgtccagccagc--tgcacctgacgccct
F7CT87_BCL2L10-01       agtcccg----gccccacctggggcaacgtggtgatgctcctggc-----
F7GTF7_MCL1-01          gccatcatgtcgccggaagaagagctggacgggtacgagccggag-----
F7GTF7_MCL1-02          gccatcatgtcgccggaagaagagctggacgggtacgagccggag-----
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        agataatgccagaa-------------cgatattcagtcaa-gtgatgga
U3DBA0_BCL2A1-01        agataatgccagaa-------------cgatattcagtcaa-gtgatgga
F7IT34_BCL2L1-02        ggacagcgtatcag---------------agctttgaacag-gtagtgaa
F7IT34_BCL2L1-01        ggacagcgtatcag---------------agctttgaacag-gtagtgaa
F7IT34_BCL2L1-03        ------------------------------gctttgaacag-gtagtgaa
A0A2R8M4C0_BCL2L2-      gttcagcccaacaa---------------cgcttcacccag-gtctccga
A0A2R8M4C0_BCL2L2-      gttcagcccaacaa---------------cgcttcacccag-gtctccga
A0A2R8MY14_BCL2-01      tcaccgcgcgggga---------------cgctttgccacg-gtggtgga
F7CT87_BCL2L10-01       ---cttcgcgggga-----------------cgctgctaga-------ga
F7GTF7_MCL1-01          ---cctctcgggaagcggccggctgtcctgcctctgctggagttggtcgg
F7GTF7_MCL1-02          ---cctctcgggaagcggccggctgtcctgcctctgctggagttggtcgg
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        aaaggaatttgaagatggcat-----------------------------
U3DBA0_BCL2A1-01        aaaggaatttgaagatggcat-----------------------------
F7IT34_BCL2L1-02        cgaactcttccgggatgg--------------------------------
F7IT34_BCL2L1-01        cgaactcttccgggatgg--------------------------------
F7IT34_BCL2L1-03        cgaactcttccgggatgg--------------------------------
A0A2R8M4C0_BCL2L2-      tgaacttttccaaggggg--------------------------------
A0A2R8M4C0_BCL2L2-      tgaacttttccaaggggg--------------------------------
A0A2R8MY14_BCL2-01      ggagctcttcagggacgg--------------------------------
F7CT87_BCL2L10-01       gggggccgctggtgaccgc-------------------------------
F7GTF7_MCL1-01          ggagcctgctaatggctccagtacggacgggtcactaccgtcgacgccgc
F7GTF7_MCL1-02          ggagcctgctaatggctccagtacggacgggtcactaccgtcgacgccgc
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        ----tattaactggggaaga------------------------------
U3DBA0_BCL2A1-01        ----tattaactggggaaga------------------------------
F7IT34_BCL2L1-02        ----ggtaaactggggtcgc------------------------------
F7IT34_BCL2L1-01        ----ggtaaactggggtcgc------------------------------
F7IT34_BCL2L1-03        ----ggtaaactggggtcgc------------------------------
A0A2R8M4C0_BCL2L2-      ----tcccaactggggccgc------------------------------
A0A2R8M4C0_BCL2L2-      ----tcccaactggggccgc------------------------------
A0A2R8MY14_BCL2-01      ----ggtgaactgggggagg------------------------------
F7CT87_BCL2L10-01       --ccggtggaagaagtgggg------------------------------
F7GTF7_MCL1-01          cgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatt
F7GTF7_MCL1-02          cgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatt
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        --attgtaaccatatttgcatttgaaggtattctc------------atc
U3DBA0_BCL2A1-01        --attgtaaccatatttgcatttgaaggtattctc------------atc
F7IT34_BCL2L1-02        --attgtggcctttttctccttcggcgg-------------------ggc
F7IT34_BCL2L1-01        --attgtggcctttttctccttcggcgg-------------------ggc
F7IT34_BCL2L1-03        --attgtggcctttttctccttcggcgg-------------------ggc
A0A2R8M4C0_BCL2L2-      --cttgtagccttctttgtctttggggc-------------------tgc
A0A2R8M4C0_BCL2L2-      --cttgtagccttctttgtctttggggc-------------------tgc
A0A2R8MY14_BCL2-01      --attgtggccttctttgagttcggtgg-------------------ggt
F7CT87_BCL2L10-01       --cttccagtctcggctgaaggagccggaaggcgac-----------gtc
F7GTF7_MCL1-01          atctctcggtaccttcgggagcaggcgaccggcgccaaggacacaaagcc
F7GTF7_MCL1-02          atctctcggtaccttcgggagcaggcgaccggcgccaaggacacaaagcc
F7GTF7_MCL1-03          -----------------------ggcgaccggcgccaaggacacaaagcc
                                               *  *                       

U3DBA0_BCL2A1-02        aagaaacttctacgagagcgaattgccccggatgtggatacttaca----
U3DBA0_BCL2A1-01        aagaaacttctacgagagcgaattgccccggatgtggatacttaca----
F7IT34_BCL2L1-02        actgtgcgtg---gaaagcg--------------------tagaca----
F7IT34_BCL2L1-01        actgtgcgtg---gaaagcg--------------------tagaca----
F7IT34_BCL2L1-03        actgtgcgtg---gaaagcg--------------------tagaca----
A0A2R8M4C0_BCL2L2-      actgtgtgct---gagagtg--------------------tcaaca----
A0A2R8M4C0_BCL2L2-      actgtgtgct---gagagtg--------------------tcaaca----
A0A2R8MY14_BCL2-01      catgtgtgtg---gagagcg--------------------tcaac-----
F7CT87_BCL2L10-01       ---------gcccgggactg--------------------ccagcg----
F7GTF7_MCL1-01          aatgggcaggtccggggccg--------------------ccagcaggaa
F7GTF7_MCL1-02          aatgggcaggtccggggccg--------------------ccagcaggaa
F7GTF7_MCL1-03          aatgggcaggtccggggccg--------------------ccagcaggaa
                                     *     *                        *     

U3DBA0_BCL2A1-02        -----aggagatctcacattttgttg--ctgagttcataatgaat-----
U3DBA0_BCL2A1-01        -----aggagatctcacattttgttg--ctgagttcataatgaat-----
F7IT34_BCL2L1-02        -----aggagatgcaggtattggtgagtcggatcgcagcttggatggcc-
F7IT34_BCL2L1-01        -----aggagatgcaggtattggtgagtcggatcgcagcttggatggcc-
F7IT34_BCL2L1-03        -----aggagatgcaggtattggtgagtcggatcgcagcttggatggcc-
A0A2R8M4C0_BCL2L2-      -----aggagatggaaccactggtgggacaagtgcaggagtggatggtg-
A0A2R8M4C0_BCL2L2-      -----aggagatggaaccactggtgggacaagtgcaggagtggatggtg-
A0A2R8MY14_BCL2-01      ----cgggagatgtcgcccctggtggacaacatcgccctgtggatgaccg
F7CT87_BCL2L10-01       ---cctggtggccttgc--tgagttcg---cggctcgtggggcagcaccg
F7GTF7_MCL1-01          ggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacg
F7GTF7_MCL1-02          ggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacg
F7GTF7_MCL1-03          ggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacg
                              ** *            **                 * *      

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        -acttacctgaatgac----------------------------------
F7IT34_BCL2L1-01        -acttacctgaatgac----------------------------------
F7IT34_BCL2L1-03        -acttacctgaatgac----------------------------------
A0A2R8M4C0_BCL2L2-      -gcctacctggagacg----------------------------------
A0A2R8M4C0_BCL2L2-      -gcctacctggagacg----------------------------------
A0A2R8MY14_BCL2-01      ag--tacct-----------------------------------------
F7CT87_BCL2L10-01       tgcctggctggaggctcagggc----------------------------
F7GTF7_MCL1-01          agacggcct-----tccaa-------------------------------
F7GTF7_MCL1-02          agacggcct-----tccaaggcatgcttcggaaactggacatcaaaaacg
F7GTF7_MCL1-03          agacggcct-----tccaaggcatgcttcggaaactggacatcaaaaacg
                                                                          

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------ggctgggtgagcaaggag
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          aagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgac
F7GTF7_MCL1-03          aagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgac
                                                                          

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------gaaccgg-----------------------------------
F7CT87_BCL2L10-01       ggggacacggggcgggatagg-----------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          ggcgtaacaaactggggtaggattgtgactctcatttcttttggtgcctt
F7GTF7_MCL1-03          ggcgtaacaaactggggtaggattgtgactctcatttcttttggtgcctt
                                                                          

U3DBA0_BCL2A1-02        ----------aacacaggagaatggataagacaaaac-------------
U3DBA0_BCL2A1-01        ----------aacacaggagaatggataagacaaaac-------------
F7IT34_BCL2L1-02        ----------cacctagagccttggatccaggagaac-------------
F7IT34_BCL2L1-01        ----------cacctagagccttggatccaggagaac-------------
F7IT34_BCL2L1-03        ----------cacctagagccttggatccaggagaac-------------
A0A2R8M4C0_BCL2L2-      ----------cggctggccgactggatccacagcagt-------------
A0A2R8M4C0_BCL2L2-      ----------cggctggccgactggatccacagcagt-------------
A0A2R8MY14_BCL2-01      ----------cacctgcacacctggatccaggataac-------------
F7CT87_BCL2L10-01       ----------cacctgggaaccgcccgccca-------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          tgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccat
F7GTF7_MCL1-03          tgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccat
                                                                          

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          tagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggcta
F7GTF7_MCL1-03          tagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggcta
                                                                          

U3DBA0_BCL2A1-02        ---------ggaggctggggga----------------------------
U3DBA0_BCL2A1-01        ---------ggaggct-gggaa----------------------------
F7IT34_BCL2L1-02        ---------ggcggct-gggac------acttttgtggaact--------
F7IT34_BCL2L1-01        ---------ggcggct-gggac------acttttgtggaact--------
F7IT34_BCL2L1-03        ---------ggcggct-gggac------acttttgtggaact--------
A0A2R8M4C0_BCL2L2-      ---------gggggct-gggcg------gagttcacagctctatacgggg
A0A2R8M4C0_BCL2L2-      ---------gggggct-gggagctggaagctatcaaagctcgagtcaggg
A0A2R8MY14_BCL2-01      ---------ggaggct-gggat------gcctttgtggaactgtatggc-
F7CT87_BCL2L10-01       ------------------cgat------ggcttttgttacttct----t-
F7GTF7_MCL1-01          ------------------ggat------gggtttgtggagttct----t-
F7GTF7_MCL1-02          gttaaacaaagaggct-gggat------gggtttgtggagttct----t-
F7GTF7_MCL1-03          gttaaacaaagaggct-gggat------gggtttgtggagttct----t-
                                           *                              

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      ---------------------------------------acgggg-----
A0A2R8M4C0_BCL2L2-      agatggaggaagaagctgagaagctaaaggaactacagaacgaggtagag
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      aagcagatgaatatgagtccacctccaggcaatgctggcccagtgatcat
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        ----------------------------------aatg------------
U3DBA0_BCL2A1-01        ----------------------------------aatg------------
F7IT34_BCL2L1-02        --ctatggaaacaatg-cggca------------gccg------------
F7IT34_BCL2L1-01        --ctatggaaacaatg-cggca------------gccg------------
F7IT34_BCL2L1-03        --ctatggaaacaatg-cggca------------gccg------------
A0A2R8M4C0_BCL2L2-      --ccctggaggaggcg-cggcg------------tctg------------
A0A2R8M4C0_BCL2L2-      gtccattgaggagaagatggag------------gctgatgcccgttcca
A0A2R8MY14_BCL2-01      --cccagcatgcggcctctgtttgatttctcctggctg------------
F7CT87_BCL2L10-01       --c-------aggacctc----------ctccttgctg------------
F7GTF7_MCL1-01          --ccatgtagaggaccta----------gaa---ggtg------------
F7GTF7_MCL1-02          --ccatgtagaggaccta----------gaa---ggtg------------
F7GTF7_MCL1-03          --ccatgtagaggaccta----------gaa---ggtg------------
                                                             *            

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        -------------------------------------agagccga-----
F7IT34_BCL2L1-01        -------------------------------------agagccga-----
F7IT34_BCL2L1-03        -------------------------------------agagccga-----
A0A2R8M4C0_BCL2L2-      ------------------------------cgggaggggaactgg-----
A0A2R8M4C0_BCL2L2-      tctatgttggcaatgtggactatggtgcaacagcagaagagctggaagct
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      cactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaa
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        -------------------------------------------------g
U3DBA0_BCL2A1-01        -------------------------------------------------g
F7IT34_BCL2L1-02        -----------------------------------------------aag
F7IT34_BCL2L1-01        -----------------------------------------------aag
F7IT34_BCL2L1-03        -----------------------------------------------aag
A0A2R8M4C0_BCL2L2-      -------------------------------------------------g
A0A2R8M4C0_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2R8MY14_BCL2-01      -------------------------------------------------t
F7CT87_BCL2L10-01       -------------------------------------------------g
F7GTF7_MCL1-01          -------------------------------------------------g
F7GTF7_MCL1-02          -------------------------------------------------g
F7GTF7_MCL1-03          -------------------------------------------------g
                                                                          

U3DBA0_BCL2A1-02        c--------acag-------------------------------------
U3DBA0_BCL2A1-01        ctttgtaaagaag-------------------------------------
F7IT34_BCL2L1-02        ggccag-gagcgcttcaaccgc----------------------------
F7IT34_BCL2L1-01        ggccag-gagcgcttcaaccgc----------------------------
F7IT34_BCL2L1-03        ggccag-gagcgcttcaaccgc----------------------------
A0A2R8M4C0_BCL2L2-      catcagtgaggac-------------------------------------
A0A2R8M4C0_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2R8MY14_BCL2-01      ctct---gaagac-------------------------------------
F7CT87_BCL2L10-01       cattatggagaaa-------------------------------------
F7GTF7_MCL1-01          catc----agaaa-------------------------------------
F7GTF7_MCL1-02          catc----agaaa-------------------------------------
F7GTF7_MCL1-03          catc----agaaa-------------------------------------
                                                                          

U3DBA0_BCL2A1-02        -----------------------------------------------tct
U3DBA0_BCL2A1-01        -----------------------------------------------ttt
F7IT34_BCL2L1-02        -------------------------------------------------t
F7IT34_BCL2L1-01        -------------------------------------------------t
F7IT34_BCL2L1-03        -------------------------------------------------t
A0A2R8M4C0_BCL2L2-      -----------------------------------------------agt
A0A2R8M4C0_BCL2L2-      cagatcaagattgactttaaggctttcatttattcatctctgactcaggt
A0A2R8MY14_BCL2-01      -----------------------------------------------tct
F7CT87_BCL2L10-01       -----------------------------------------------agt
F7GTF7_MCL1-01          -----------------------------------------------tgt
F7GTF7_MCL1-02          -----------------------------------------------tgt
F7GTF7_MCL1-03          -----------------------------------------------tgt
                                                                         *

U3DBA0_BCL2A1-02        catgcttatg----------------------------ctagt---at--
U3DBA0_BCL2A1-01        gaacctaaat----------------------------ctggctggat--
F7IT34_BCL2L1-02        ggttc---------------------------------ctgacgggca--
F7IT34_BCL2L1-01        ggttc---------------------------------ctgacgggca--
F7IT34_BCL2L1-03        ggttc---------------------------------ctgacgggca--
A0A2R8M4C0_BCL2L2-      g-------------------------------------ctgacagggg--
A0A2R8M4C0_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2R8MY14_BCL2-01      g-------------------------------------ctcagcttgg--
F7CT87_BCL2L10-01       g-------------------------------------ctggtccagg--
F7GTF7_MCL1-01          g-------------------------------------ctg--ctggc--
F7GTF7_MCL1-02          g-------------------------------------ctg--ctggc--
F7GTF7_MCL1-03          g-------------------------------------ctg--ctggc--
                                                              *           

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        --------------------------------------------------
F7IT34_BCL2L1-02        --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
F7IT34_BCL2L1-03        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      ttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgc
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
F7GTF7_MCL1-03          --------------------------------------------------
                                                                          

U3DBA0_BCL2A1-02        ---cagtggcccagaagaagaggaaaatggctttgtaa------------
U3DBA0_BCL2A1-01        ---gacttttctagaagttacaggaaagatctgcgaaatgctatctctct
F7IT34_BCL2L1-02        --------tgactgtggc---------------cggcgtggt-tc-----
F7IT34_BCL2L1-01        --------tgactgtggc---------------cggcgtggt-tc-----
F7IT34_BCL2L1-03        --------tgactgtggc---------------cggcgtggt-tc-----
A0A2R8M4C0_BCL2L2-      -----------ccgtggc----actgggggccctg-----gtaac-----
A0A2R8M4C0_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtc-----
A0A2R8MY14_BCL2-01      ------tcctg--------------gtgggagc-----ttgcatcaccct
F7CT87_BCL2L10-01       ------ttttcctgtcatggttg--ttaacagcagtattcatctacttct
F7GTF7_MCL1-01          ------ttttgcgggtgttgctggagtaggagctgggttggcatatc---
F7GTF7_MCL1-02          ------ttttgcgggtgttgctggagtaggagctgggttggcatatc---
F7GTF7_MCL1-03          ------ttttgcgggtgttgctggagtaggagctgggttggcatatc---
                                                                          

U3DBA0_BCL2A1-02        --------------------------------------------------
U3DBA0_BCL2A1-01        tgaagcaatactgttg----------------------------------
F7IT34_BCL2L1-02        --------tgctgggc---tc-------------------actctttagt
F7IT34_BCL2L1-01        --------tgctgggc---tc-------------------actctttagt
F7IT34_BCL2L1-03        --------tgctgggc---tc-------------------actctttagt
A0A2R8M4C0_BCL2L2-      --------tgtagggg---cc--------------------ttttttgct
A0A2R8M4C0_BCL2L2-      --------tacagggg---ccgggctagagcgacatcatggtattcccct
A0A2R8MY14_BCL2-01      gggtgcc-tatctggg---------------------------------c
F7CT87_BCL2L10-01       ggacacgataatgagg-agttttaaaagttttagcccacttctacctgcc
F7GTF7_MCL1-01          --------taataagatagccttggaa-----------------------
F7GTF7_MCL1-02          --------taataagatag-------------------------------
F7GTF7_MCL1-03          --------taataagatag-------------------------------
                                                                          

U3DBA0_BCL2A1-02        ---------
U3DBA0_BCL2A1-01        --------a
F7IT34_BCL2L1-02        cggaaatga
F7IT34_BCL2L1-01        cggaaatga
F7IT34_BCL2L1-03        cggaaatga
A0A2R8M4C0_BCL2L2-      agcaagtga
A0A2R8M4C0_BCL2L2-      tac---taa
A0A2R8MY14_BCL2-01      cacaagtga
F7CT87_BCL2L10-01       caactgtga
F7GTF7_MCL1-01          ---------
F7GTF7_MCL1-02          ---------
F7GTF7_MCL1-03          ---------
                                 

© 1998-2018