Dataset for CDS BCL2L2 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2R8M4C0_BCL2L2-      cttctggttctctgtccatatattaatgccagtctttcatccttgcctct
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8M4C0_BCL2L2-      tatagctgcccggatggcgaccccagcctccgccccagacacacgggctc
A0A2R8M4C0_BCL2L2-      -------------atggcgaccccagcctccgccccagacacacgggctc
                                     *************************************

A0A2R8M4C0_BCL2L2-      tggtggcagactttgtaggttataagctgaggcagaaaggttatgtctgt
A0A2R8M4C0_BCL2L2-      tggtggcagactttgtaggttataagctgaggcagaaaggttatgtctgt
                        **************************************************

A0A2R8M4C0_BCL2L2-      ggaactggccccggggagggcccagcagctgacccgctgcaccaagcaat
A0A2R8M4C0_BCL2L2-      ggaactggccccggggagggcccagcagctgacccgctgcaccaagcaat
                        **************************************************

A0A2R8M4C0_BCL2L2-      gcgggcagctggagatgaattcgagacccgcttccggcgcaccttctctg
A0A2R8M4C0_BCL2L2-      gcgggcagctggagatgaattcgagacccgcttccggcgcaccttctctg
                        **************************************************

A0A2R8M4C0_BCL2L2-      atctggcggctcagctgcatgtgaccccaggttcagcccaacaacgcttc
A0A2R8M4C0_BCL2L2-      atctggcggctcagctgcatgtgaccccaggttcagcccaacaacgcttc
                        **************************************************

A0A2R8M4C0_BCL2L2-      acccaggtctccgatgaacttttccaagggggtcccaactggggccgcct
A0A2R8M4C0_BCL2L2-      acccaggtctccgatgaacttttccaagggggtcccaactggggccgcct
                        **************************************************

A0A2R8M4C0_BCL2L2-      tgtagccttctttgtctttggggctgcactgtgtgctgagagtgtcaaca
A0A2R8M4C0_BCL2L2-      tgtagccttctttgtctttggggctgcactgtgtgctgagagtgtcaaca
                        **************************************************

A0A2R8M4C0_BCL2L2-      aggagatggaaccactggtgggacaagtgcaggagtggatggtggcctac
A0A2R8M4C0_BCL2L2-      aggagatggaaccactggtgggacaagtgcaggagtggatggtggcctac
                        **************************************************

A0A2R8M4C0_BCL2L2-      ctggagacgcggctggccgactggatccacagcagtgggggctgggcg--
A0A2R8M4C0_BCL2L2-      ctggagacgcggctggccgactggatccacagcagtgggggctgggagct
                        ********************************************** *  

A0A2R8M4C0_BCL2L2-      ----gagttcacagctctatacgggg------------------------
A0A2R8M4C0_BCL2L2-      ggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaagc
                            *   *** ***** *  * ***                        

A0A2R8M4C0_BCL2L2-      ---------------acgggg-----------------------------
A0A2R8M4C0_BCL2L2-      taaaggaactacagaacgaggtagagaagcagatgaatatgagtccacct
                                       *** **                             

A0A2R8M4C0_BCL2L2-      ----------------------------ccctggaggaggcg-cggcgtc
A0A2R8M4C0_BCL2L2-      ccaggcaatgctggcccagtgatcatgtccattgaggagaagatggaggc
                                                    ** * ******  *  ** * *

A0A2R8M4C0_BCL2L2-      tg------------------------------------------cgggag
A0A2R8M4C0_BCL2L2-      tgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcag
                        **                                          * * **

A0A2R8M4C0_BCL2L2-      gggaactgg-----------------------------------------
A0A2R8M4C0_BCL2L2-      aagagctggaagctcactttcatggctgtggttcagtcaaccgtgttacc
                          ** ****                                         

A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      atactctgtgacaaatttagtggccatcccaaagggtttgcatatataga
                                                                          

A0A2R8M4C0_BCL2L2-      -------------gcatcagtgaggac-----------------------
A0A2R8M4C0_BCL2L2-      gttctcagacaaagagtcagtgaggacttccttggccttagatgagtccc
                                     *  ***********                       

A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      tatttagaggaaggcagatcaagattgactttaaggctttcatttattca
                                                                          

A0A2R8M4C0_BCL2L2-      -----------agtg-----------------------------------
A0A2R8M4C0_BCL2L2-      tctctgactcaggtgatcccaaaacgaaccaacagaccaggcatcagcac
                                    ***                                   

A0A2R8M4C0_BCL2L2-      --ctgacagggg--------------------------------------
A0A2R8M4C0_BCL2L2-      aacagaccggggttttccacgagcccgctaccgcgcacggaccaccaact
                          * *** ****                                      

A0A2R8M4C0_BCL2L2-      -------------------------ccgtggc----actgggggccctg-
A0A2R8M4C0_BCL2L2-      acaacagttcccgctctcgattctacagtggttttaacagcaggccccgg
                                                 * ****     ** *  ***** * 

A0A2R8M4C0_BCL2L2-      ----gtaactgtaggggcc--------------------ttttttgctag
A0A2R8M4C0_BCL2L2-      ggtcgcgtctacaggggccgggctagagcgacatcatggtattcccctta
                            *   **  *******                    * **   **  

A0A2R8M4C0_BCL2L2-      caagtga
A0A2R8M4C0_BCL2L2-      c---taa
                        *   * *

© 1998-2018