Dataset for CDS BCL2L1 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F7IT34_BCL2L1-02      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
F7IT34_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
F7IT34_BCL2L1-03      --------------------------------------------------

F7IT34_BCL2L1-02      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
F7IT34_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
F7IT34_BCL2L1-03      -----------------------------------atgtggaagagaaca

F7IT34_BCL2L1-02      ggactgaggccccagaagggactgattcggagatggagacccccagtgcc
F7IT34_BCL2L1-01      ggactgaggccccagaagggactgattcggagatggagacccccagtgcc
F7IT34_BCL2L1-03      ggactgaggccccagaagggactgattcggagatggagacccccagtgcc

F7IT34_BCL2L1-02      atcaatggcaacccatcctggcacctggcggacagcccagtggtgaatgg
F7IT34_BCL2L1-01      atcaatggcaacccatcctggcacctggcggacagcccagtggtgaatgg
F7IT34_BCL2L1-03      atcaatggcaacccatcctggcacctggcggacagcccagt---------

F7IT34_BCL2L1-02      agccacgggccacagcagcagtttggatgcccgggaggtgatccccatgg
F7IT34_BCL2L1-01      agccacgggccacagcagcagtttggatgcccgggaggtgatccccatgg
F7IT34_BCL2L1-03      --------------------------------------------------

F7IT34_BCL2L1-02      cagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcgg
F7IT34_BCL2L1-01      cagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcgg
F7IT34_BCL2L1-03      --------------------------------------------------

F7IT34_BCL2L1-02      taccggcgggcatttagtgacctgacatcccagctccacatcacccccgg
F7IT34_BCL2L1-01      taccggcgggcatttagtgacctgacatcccagctccacatcacccccgg
F7IT34_BCL2L1-03      --------------------------------------------------

F7IT34_BCL2L1-02      gacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
F7IT34_BCL2L1-01      gacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
F7IT34_BCL2L1-03      --------------gctttgaacaggtagtgaacgaactcttccgggatg

F7IT34_BCL2L1-02      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
F7IT34_BCL2L1-01      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
F7IT34_BCL2L1-03      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg

F7IT34_BCL2L1-02      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
F7IT34_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
F7IT34_BCL2L1-03      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc

F7IT34_BCL2L1-02      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
F7IT34_BCL2L1-01      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
F7IT34_BCL2L1-03      agcttggatggccacttacctgaatgaccacctagagccttggatccagg

F7IT34_BCL2L1-02      agaacggcggctgggacacttttgtggaactctatggaaacaatgcggca
F7IT34_BCL2L1-01      agaacggcggctgggacacttttgtggaactctatggaaacaatgcggca
F7IT34_BCL2L1-03      agaacggcggctgggacacttttgtggaactctatggaaacaatgcggca

F7IT34_BCL2L1-02      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
F7IT34_BCL2L1-01      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
F7IT34_BCL2L1-03      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg

F7IT34_BCL2L1-02      catgactgtggccggcgtggttctgctgggctcactctttagtcggaaat
F7IT34_BCL2L1-01      catgactgtggccggcgtggttctgctgggctcactctttagtcggaaat
F7IT34_BCL2L1-03      catgactgtggccggcgtggttctgctgggctcactctttagtcggaaat

F7IT34_BCL2L1-02      ga
F7IT34_BCL2L1-01      ga
F7IT34_BCL2L1-03      ga

© 1998-2019