Dataset for CDS BCL2A1 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


U3DBA0_BCL2A1-01      atgacagactctgaatttggatatattcacaatctaactcaggactatct
U3DBA0_BCL2A1-02      atgacagactctgaatttggatatattcacaatctaactcaggactatct
                      **************************************************

U3DBA0_BCL2A1-01      gcagtacgtcctgcagataccacagtctggaatgggtccgagcaaaacgt
U3DBA0_BCL2A1-02      gcagtacgtcctgcagataccacagtctggaatgggtccgagcaaaacgt
                      **************************************************

U3DBA0_BCL2A1-01      ctagagtgctacaacaggttgcattctcagtccaaaaagaagtggaaaag
U3DBA0_BCL2A1-02      ctagagtgctacaacaggttgcattctcagtccaaaaagaagtggaaaag
                      **************************************************

U3DBA0_BCL2A1-01      agtctgaagtcatgcttggacaatgttgatattgcgtccatagataatgc
U3DBA0_BCL2A1-02      agtctgaagtcatgcttggacaatgttgatattgcgtccatagataatgc
                      **************************************************

U3DBA0_BCL2A1-01      cagaacgatattcagtcaagtgatggaaaaggaatttgaagatggcatta
U3DBA0_BCL2A1-02      cagaacgatattcagtcaagtgatggaaaaggaatttgaagatggcatta
                      **************************************************

U3DBA0_BCL2A1-01      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
U3DBA0_BCL2A1-02      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
                      **************************************************

U3DBA0_BCL2A1-01      aagaaacttctacgagagcgaattgccccggatgtggatacttacaagga
U3DBA0_BCL2A1-02      aagaaacttctacgagagcgaattgccccggatgtggatacttacaagga
                      **************************************************

U3DBA0_BCL2A1-01      gatctcacattttgttgctgagttcataatgaataacacaggagaatgga
U3DBA0_BCL2A1-02      gatctcacattttgttgctgagttcataatgaataacacaggagaatgga
                      **************************************************

U3DBA0_BCL2A1-01      taagacaaaacggaggct-gggaaaatggctttgtaaagaagtttgaacc
U3DBA0_BCL2A1-02      taagacaaaacggaggctgggggaaatggc--------acagtctcatgc
                      ****************** *** *******          *** * *  *

U3DBA0_BCL2A1-01      taaatctggctggatgacttttctagaagttacaggaaagatctgcgaaa
U3DBA0_BCL2A1-02      ttatgctagt---atcagtggcccagaagaagaggaaaatggctttgtaa
                      * *  ** *    ** * *   * *****     * ***   **  * **

U3DBA0_BCL2A1-01      tgctatctctcttgaagcaatactgttga
U3DBA0_BCL2A1-02      -----------------------------
                                                   

© 1998-2018