Dataset for CDS MCL-1 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A5PJR2_MCL1-01      atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccgga
F1MQX4_MCL1-01      -tgtc-------------------------------aacct-------------------
                     ***                                *****                   

A5PJR2_MCL1-01      ttaggacagggcagcggcgcctcctctccgggggggcggcttttggctgcggggaaggag
F1MQX4_MCL1-01      ------------------------------------------------------------
                                                                                

A5PJR2_MCL1-01      gccacggcgcggcgagaggtagggggaggggaagccggcacggtgattggcggaagcgcc
F1MQX4_MCL1-01      ------------------------------------------------------------
                                                                                

A5PJR2_MCL1-01      ggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
F1MQX4_MCL1-01      ------------------------------------------------------------
                                                                                

A5PJR2_MCL1-01      attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
F1MQX4_MCL1-01      -------------------------------cccccaccaa-------------------
                                                   *********                    

A5PJR2_MCL1-01      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgccatcatgtcg
F1MQX4_MCL1-01      -------------------ctgaagagatggaatccctgatctccgatgccatcatgtcg
                                       ****************** ********* ************

A5PJR2_MCL1-01      cccgaagaggagctggacgggtgcgagccagaccctctcgggaagcggcctgccgtccgg
F1MQX4_MCL1-01      cccgaagaggagccggacgggtgcaagccagaccctctcgggaagcggcctgccgtccgg
                    ************* ********** ***********************************

A5PJR2_MCL1-01      cctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
F1MQX4_MCL1-01      cctttacctttgttggtcagagaagccagtaacaacagtccaggctcggacggctcgctg
                    ****************** *****************************************

A5PJR2_MCL1-01      ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggag
F1MQX4_MCL1-01      ccctcgacgccgcccccagcagaggaggaggaggacaagttatattggcagtccctggag
                    ************************************ ******** **************

A5PJR2_MCL1-01      ataatctctcagtacctccgggagcaggcaaccggcgccaaggacgcgaagcccctgggc
F1MQX4_MCL1-01      attatctctcggtacctccgggagcaggcaaccggcgccaaggatgtgaagcccctgggc
                    ** ******* ********************************* * *************

A5PJR2_MCL1-01      gggtctgggaccacaagccggaaggcgttggagaccctgcgccgagtcggggatggggtg
F1MQX4_MCL1-01      gggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcggggatggggtg
                    ********* **** ************************* *******************

A5PJR2_MCL1-01      cagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaatgaa
F1MQX4_MCL1-01      cagcacaaccacgagacggctttccaaggcgtgcttcagaaactggacatcaaaaacgaa
                    **** ************************* ****** ****************** ***

A5PJR2_MCL1-01      gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaac
F1MQX4_MCL1-01      gacgatgttaaatctttgtctcgagtgatggttcatgttttcagtgacagagtaacaaac
                    ******** *************************************** ***********

A5PJR2_MCL1-01      tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagt
F1MQX4_MCL1-01      tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacactttaagagt
                    ***************************************************** ******

A5PJR2_MCL1-01      ataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
F1MQX4_MCL1-01      ataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
                    ************************************************************

A5PJR2_MCL1-01      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
F1MQX4_MCL1-01      tcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccat
                    ************************ ***********************************

A5PJR2_MCL1-01      gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccgga
F1MQX4_MCL1-01      gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccgga
                    ************************************************************

A5PJR2_MCL1-01      gtaggagctggtttggcatatctaataagatag
F1MQX4_MCL1-01      gtaggagctggtttggcatatctaataagatag
                    *********************************

© 1998-2018