Dataset for CDS BCL-2-like of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q3C2I0_BCL2A1-01       ------atg-----------------------------------------
Q05KJ0_BCL2L1-01       ------atg-----------------------------------------
E1B9B3_BCL2L10-01      ggagccatg-----------------------------------------
F1MV39_BCL2L10-01      ggagccatg-----------------------------------------
F6R2C4_BCL2-01         ------atg-----------------------------------------
O02718_BCL2-01         ------atg-----------------------------------------
Q05KI8_BCL2L2-01       ------atg-----------------------------------------
Q1RMX3_BCL2L2-01       ------atg-----------------------------------------
A5PJR2_MCL1-01         ------atgttcggcctcaagagaaacgcagtaatcggactaaacctcta
F1MQX4_MCL1-01         -------tgtc-------------------------------aacct---
                              **                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------------------------------------------
O02718_BCL2-01         --------------------------------------------------
Q05KI8_BCL2L2-01       --------------------------------------------------
Q1RMX3_BCL2L2-01       --------------------------------------------------
A5PJR2_MCL1-01         ttgtgggggagccggattaggacagggcagcggcgcctcctctccggggg
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------------------------------------------
O02718_BCL2-01         --------------------------------------------------
Q05KI8_BCL2L2-01       --------------------------------------------------
Q1RMX3_BCL2L2-01       --------------------------------------------------
A5PJR2_MCL1-01         ggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtaggg
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------------------------------------------
O02718_BCL2-01         --------------------------------------------------
Q05KI8_BCL2L2-01       --------------------------------------------------
Q1RMX3_BCL2L2-01       --------------------------------------------------
A5PJR2_MCL1-01         ggaggggaagccggcacggtgattggcggaagcgccggcccgagcccccc
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------------------------------------------
O02718_BCL2-01         --------------------------------------------------
Q05KI8_BCL2L2-01       --------------------------------------------------
Q1RMX3_BCL2L2-01       --------------------------------------------------
A5PJR2_MCL1-01         ggccactcttgcgcccgacgcccggagggtcgcgcggccctcgcccattg
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
E1B9B3_BCL2L10-01      -----------------------gtggaccc-------------------
F1MV39_BCL2L10-01      -----------------------gtggaccc-------------------
F6R2C4_BCL2-01         -----------------------gcgcacgc-------------------
O02718_BCL2-01         -----------------------gcgcacgc-------------------
Q05KI8_BCL2L2-01       -----------------------gcgacccc-------------------
Q1RMX3_BCL2L2-01       -----------------------gcgacccc-------------------
A5PJR2_MCL1-01         gcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttc
F1MQX4_MCL1-01         ---------------------------cccccaccaa-------------
                                                                         

Q3C2I0_BCL2A1-01       ------------------------------------------------ac
Q05KJ0_BCL2L1-01       --------------------------------------tctcagagtaac
E1B9B3_BCL2L10-01      ------------------------gtttagggagcgcaccgcccggctgc
F1MV39_BCL2L10-01      ------------------------gtttagggagcgcaccgcccggctgc
F6R2C4_BCL2-01         ----------------------------ggggggaacaggctacgataac
O02718_BCL2-01         ----------------------------ggggggaacaggctacgataac
Q05KI8_BCL2L2-01       --------------------------------------agcctcggcccc
Q1RMX3_BCL2L2-01       --------------------------------------agcctcggcccc
A5PJR2_MCL1-01         gcgcccacacgcctcgcgtcgccgcctgaagagatggaatccccgatctc
F1MQX4_MCL1-01         -------------------------ctgaagagatggaatccctgatctc
                                                                        *

Q3C2I0_BCL2A1-01       tga--------cactgagttt----------ggctacgttcacggg----
Q05KJ0_BCL2L1-01       cgggagctggtggttgactttctctcttacaagctttcccagaaaggata
E1B9B3_BCL2L10-01      tgatggactacc-tggagttctgcgcccgggagc--------cgggcact
F1MV39_BCL2L10-01      tgatggactacc-tggagttctgcgcccgggagc--------cgggcact
F6R2C4_BCL2-01         cgagagatcgtgatgaagtacatccactataagctgtcgcagcggggcta
O02718_BCL2-01         cgagagatcgtgatgaagtacatccactataagctgtcgcagcggggcta
Q05KI8_BCL2L2-01       aga-----cac------------------------------acggg--ct
Q1RMX3_BCL2L2-01       aga-----cac------------------------------acggg--ct
A5PJR2_MCL1-01         cga-----cgccatcatgtcgcccgaagaggagctg----gacggg--tg
F1MQX4_MCL1-01         cga-----tgccatcatgtcgcccgaagaggagccg----gacggg--tg
                        *                                           *    

Q3C2I0_BCL2A1-01       ctggctgaggactatctgaa-------------------------atatg
Q05KJ0_BCL2L1-01       c-agctggagtcagtttagtgatgtggaagagaacagaactgaggcccca
E1B9B3_BCL2L10-01      ccagc----------------------------------------tcctg
F1MV39_BCL2L10-01      ccagc----------------------------------------tcctg
F6R2C4_BCL2-01         cgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccg
O02718_BCL2-01         cgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccg
Q05KI8_BCL2L2-01       ctagtggcaga------------------------------------ctt
Q1RMX3_BCL2L2-01       ctagtggcaga------------------------------------ctt
A5PJR2_MCL1-01         cgagc--cagaccctctcgggaagcggcctgccgtcc-ggcctttacctt
F1MQX4_MCL1-01         caagc--cagaccctctcgggaagcggcctgccgtcc-ggcctttacctt
                       *  *                                              

Q3C2I0_BCL2A1-01       tgttgcagata---------------------------------------
Q05KJ0_BCL2L1-01       gaagggacaga-------------------------------atcagata
E1B9B3_BCL2L10-01      cgccgtccacg---------------------------------------
F1MV39_BCL2L10-01      cgccgtccacg---------------------------------------
F6R2C4_BCL2-01         cgccgggcatc------------------------------------ctg
O02718_BCL2-01         cgccgggcatc------------------------------------ctg
Q05KI8_BCL2L2-01       tgtgggctata---------------------------------------
Q1RMX3_BCL2L2-01       tgtgggctata---------------------------------------
A5PJR2_MCL1-01         tgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
F1MQX4_MCL1-01         tgttggtcagagaagccagtaacaacagtccaggctcggacggctcgctg
                           *                                             

Q3C2I0_BCL2A1-01       -cagcaacctggatccaagccaagc-------------------------
Q05KJ0_BCL2L1-01       tggaaacccccagtgccatcaatggcaa------------cgcatcctgg
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         tcct----------cccagccgggccg-------------cacacccgcg
O02718_BCL2-01         tcct----------cccagccgggccg-------------cacacccgcc
Q05KI8_BCL2L2-01       -----------------agctgaggcagaagggg------tatgtttg--
Q1RMX3_BCL2L2-01       -----------------agctgaggcagaagggg------tatgtttg--
A5PJR2_MCL1-01         ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggca
F1MQX4_MCL1-01         ccctcgacgccgcccccagcagaggaggaggaggacaagttatattggca
                                                                         

Q3C2I0_BCL2A1-01       ---------------------------aaaacatccag------------
Q05KJ0_BCL2L1-01       cacctggcggatagccctgctgtgaatggagccactggccacagcagaag
E1B9B3_BCL2L10-01      ----------------------------------cctgaggctgccgt--
F1MV39_BCL2L10-01      ----------------------------------cctgaggctgccgt--
F6R2C4_BCL2-01         ccctccaggacctccccgcc-------gccgcccccggccgccgccgccg
O02718_BCL2-01         ccctccaggacctccccgcc-------gccgcccccggccgccgccgccg
Q05KI8_BCL2L2-01       -----tggagctggccccgg-------ggagggcccagcagctgaccc--
Q1RMX3_BCL2L2-01       -----tggagctggccccgg-------ggagggcccagcagctgaccc--
A5PJR2_MCL1-01         gtccctggagataatctctc-------agtacctccgggagcaggcaa--
F1MQX4_MCL1-01         gtccctggagattatctctc-------ggtacctccgggagcaggcaa--
                                                         *  *            

Q3C2I0_BCL2A1-01       --ggtgttacaagatgtggcttcctctgtccaggacgaagtggaaaggac
Q05KJ0_BCL2L1-01       ctcggatgcccgggaagtg-atccccatggcagc----ggtgaagcaagc
E1B9B3_BCL2L10-01      --gctgcgcca--------------cgtggccgcacgt------------
F1MV39_BCL2L10-01      --gctgcgcca--------------cgtggccgcacgt------------
F6R2C4_BCL2-01         ggcctgcgcccag----------cccggtgccgcctgtggtgcacctgac
O02718_BCL2-01         ggcctgcgcccag----------cccggtgccgcctgtggtgcacctgac
Q05KI8_BCL2L2-01       --gctacaccaag------------ccatgcggg-----------c----
Q1RMX3_BCL2L2-01       --gctacaccaag------------ccatgcggg-----------c----
A5PJR2_MCL1-01         --ccggcgccaaggacgcgaagcccctgggcgggtctgggaccaca----
F1MQX4_MCL1-01         --ccggcgccaaggatgtgaagcccctgggcgggtctggggccacc----
                                *               *    * *                 

Q3C2I0_BCL2A1-01       tctgaagcagtgcttggataagtttgatgtggtgtccgtagacactgcc-
Q05KJ0_BCL2L1-01       cctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattca
E1B9B3_BCL2L10-01      ---------atccaggaagcaaatcgaaacgtcttgcccctataccgccg
F1MV39_BCL2L10-01      ---------atccaggaagcaaatcgaaatgtcttgcccctataccgccg
F6R2C4_BCL2-01         cctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcg
O02718_BCL2-01         cctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcg
Q05KI8_BCL2L2-01       ---------agctggagatgagttcgagacccgcttccggcgcaccttct
Q1RMX3_BCL2L2-01       ---------agctggagatgagttcgagacccgcttccggcgcaccttct
A5PJR2_MCL1-01         ---------agccgga-aggcgttggagaccc--------tgcgccgagt
F1MQX4_MCL1-01         ---------agccgga-aggcgttggagaccc--------tgcaccgagt
                                        *     *                          

Q3C2I0_BCL2A1-01       ---------------------------------------------agaac
Q05KJ0_BCL2L1-01       gcgacctg----acgtcccagctccacatcacccc----------aggga
E1B9B3_BCL2L10-01      ctg---------------ccgc-----------------------aggca
F1MV39_BCL2L10-01      ctg---------------ccgc-----------------------aggca
F6R2C4_BCL2-01         ccgagatg----tccagtcagctgcacctgacgcccttcaccgcgagggg
O02718_BCL2-01         ccgagatg----tccagtcagctgcacctgacgcccttcaccgcgaggga
Q05KI8_BCL2L2-01       ccgatctg----gcagctcagctgcatgtgac------cc-----cgggc
Q1RMX3_BCL2L2-01       ccgatctg----gcagctcagctgcatgtgac------cc-----cgggc
A5PJR2_MCL1-01         cggggatggggtgcagcgcaac--cacgagacggctttcc-----aaggc
F1MQX4_MCL1-01         cggggatggggtgcagcacaac--cacgagacggctttcc-----aaggc
                                                                         

Q3C2I0_BCL2A1-01       aatattca-----------------------------------------a
Q05KJ0_BCL2L1-01       cagcat------------------------------atcagagctttgaa
E1B9B3_BCL2L10-01      ccgcgtcg--------------------------------agctggtggc
F1MV39_BCL2L10-01      ccgcgtcg--------------------------------agctggtggc
F6R2C4_BCL2-01         acgcttcg-----------------------------------------c
O02718_BCL2-01         acgcttcg-----------------------------------------c
Q05KI8_BCL2L2-01       tcggcccagcaac-----------------------gcttcacccaggtc
Q1RMX3_BCL2L2-01       tcggcccagcaac-----------------------gcttcacccaggtc
A5PJR2_MCL1-01         atgcttcggaaactggacatcaaaaatgaagacgatgtcaaatctttgtc
F1MQX4_MCL1-01         gtgcttcagaaactggacatcaaaaacgaagacgatgttaaatctttgtc
                                                                         

Q3C2I0_BCL2A1-01       ccaagtgatggaaaaggaatttgaagatggcattgt---taactggggca
Q05KJ0_BCL2L1-01       ca-ggtagtgaatgaactcttccgggacgg---ggt---gaactggggtc
E1B9B3_BCL2L10-01      caggatggcgcagaggctactcgacgaagaccctggccccagctggggcc
F1MV39_BCL2L10-01      caggatggcgcagaggctactcgacgaagaccctggccccagctggggcc
F6R2C4_BCL2-01         cacggtggtggaggagctcttcagggacgg---ggt---gaactgggggc
O02718_BCL2-01         cacggtggtggaggagctcttcagggacgg---ggt---gaactgggggc
Q05KI8_BCL2L2-01       tctgatga------actcttccaa----gg---gggccccaactggggcc
Q1RMX3_BCL2L2-01       tctgatga------actcttccaa----gg---gggccccaactggggcc
A5PJR2_MCL1-01         tcgagtgatggttcatgttttcagtgacgg---agtaacaaactggggca
F1MQX4_MCL1-01         tcgagtgatggttcatgttttcagtgacag---agtaacaaactggggca
                            *                            *     * ******  

Q3C2I0_BCL2A1-01       ggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctg
Q05KJ0_BCL2L1-01       gcattgtggcctttttctccttcggtggggcactgtgc-----------g
E1B9B3_BCL2L10-01      gcgtggcctcactcgtaaccttcgcggggtcgctgctggagaggccaccg
F1MV39_BCL2L10-01      gcgtggcctcactcgtgaccttcgcggggtcgctgctggagaggccgccg
F6R2C4_BCL2-01         gcatcgtggccttctttgagttcggaggggtcatgtgt-----------g
O02718_BCL2-01         gcatcgtggccttctttgagttcggaggggtcatgtgt-----------g
Q05KI8_BCL2L2-01       gccttgtggccttctttgtctttggagccgcgttgtgt-----------g
Q1RMX3_BCL2L2-01       gccttgtggccttctttgtctttggagccgcgttgtgt-----------g
A5PJR2_MCL1-01         ggattgtgactcttatttcttttggtgc--ctttgtgg-----------c
F1MQX4_MCL1-01         ggattgtgactcttatttcttttggtgc--ctttgtgg-----------c
                       *  * *   *  *  *    ** *  *      *                

Q3C2I0_BCL2A1-01       ---------ggcaagtgtattgcctcag------acatggacatgtgcaa
Q05KJ0_BCL2L1-01       t--------ggaaagcgtagacaaggag------atgcaggtattggtga
E1B9B3_BCL2L10-01      cagacgacccgacggcaggagaagagagacg---acgacggcgttagcag
F1MV39_BCL2L10-01      cagactacccgacggc---agaagagagacg---acgacggcgttagcag
F6R2C4_BCL2-01         t--------ggagagcgtcaaccgggag------atgtcgcccctggtgg
O02718_BCL2-01         t--------ggagagcgtcaaccgggag------atgtcgcccctggtgg
Q05KI8_BCL2L2-01       c--------tgagagtgtcaacaaggag------atggagccacttgtgg
Q1RMX3_BCL2L2-01       c--------tgagagtgtcaacaaggag------atggagccacttgtgg
A5PJR2_MCL1-01         caaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcag
F1MQX4_MCL1-01         caaacactttaagagtataaatcaagaaagctgcatcgaaccactagcag
                                     *           *       *           *   

Q3C2I0_BCL2A1-01       ggacatttctttctttgtggcggagttc---------atcaccgaaaata
Q05KJ0_BCL2L1-01       gtcggatcgcaacttggatggccactta-------c-ctgaatgaccacc
E1B9B3_BCL2L10-01      ggactgtcggctcctggtggcccttctgtgtgctcagttctgcgaaaggc
F1MV39_BCL2L10-01      ggactgtcggctcctggtggcccttctgtgtgctcagttctgcgaaaggc
F6R2C4_BCL2-01         acagcatcgccctgtggatgaccgagta-------c-ctgaaccggcacc
O02718_BCL2-01         acagcatcgccctgtggatgaccgagta-------c-ctgaaccggcacc
Q05KI8_BCL2L2-01       gacaagtgcaggagtggatggtggccta-------c-ctggagacgaggc
Q1RMX3_BCL2L2-01       gacaagtgcaggagtggatggtggccta-------c-ctggagacgaggc
A5PJR2_MCL1-01         aaagcat-----cacagatgttctcgta-------aggtcaaaacga---
F1MQX4_MCL1-01         aaagcat-----cacagatgttctcgta-------aggtcaaaacga---
                             *         *  *      *           *           

Q3C2I0_BCL2A1-01       caggagagtggataaagcaaaatggaggctgggaaaatgggtttgtaaag
Q05KJ0_BCL2L1-01       tagagccttggatccaggagaacggcggctggg---acacttttgtggaa
E1B9B3_BCL2L10-01      accgcgcctggctgatgactaacggcggctggg---atggattt-tgtct
F1MV39_BCL2L10-01      accgcgcctggctgatggctaacggcggctggg---atggattt-tgtct
F6R2C4_BCL2-01         tgcacacctggatccaggacaacggaggctggg---acgcctttgtggag
O02718_BCL2-01         tgcacacctggatccaggacaacggaggctggg---acgcctttgtggag
Q05KI8_BCL2L2-01       tggctgactggatccacagcagtgggggctggg---cggagttcacagct
Q1RMX3_BCL2L2-01       tggctgactggatccacagcagtgggggctggg---cggagttcacagct
A5PJR2_MCL1-01         -----gactggatagtcaaacaaagaggctggg---atgggtttgtggag
F1MQX4_MCL1-01         -----gactggatagtcaaagaaagaggctggg---atgggtttgtggag
                               *** *           * *******        **       

Q3C2I0_BCL2A1-01       aagtttgaaaccaaa-----------------------tctgg-------
Q05KJ0_BCL2L1-01       ctctacgggaacaatgcagcagccgagagccggaagggccaggagcgctt
E1B9B3_BCL2L10-01      cttcttcagccactcattccagc----------ca---tcttgggaaaga
F1MV39_BCL2L10-01      ctttttcagccagtcattccagc----------ca---tcttgggaaaga
F6R2C4_BCL2-01         ctgtat--------ggccctagcat----gcggcc---cctgtttgattt
O02718_BCL2-01         ctgtat--------ggccctagcat----gcggcc---cctgtttgattt
Q05KI8_BCL2L2-01       ctatacggggtcggggccctggaggaggcgcggcg---tctgcgggaggg
Q1RMX3_BCL2L2-01       ctatacggggacggggccctggaggaggcgcggcg---tctgcgggaggg
A5PJR2_MCL1-01         ttcttccatgtagaggacctagaag----gcggca---tc---------a
F1MQX4_MCL1-01         ttcttccatgtagaggacctagaag----gcggca---tc---------a
                                                              *          

Q3C2I0_BCL2A1-01       ---ctggctg--------------acttttctggaagttacagga-----
Q05KJ0_BCL2L1-01       caaccgctggttcctg-----acgggcatgactgtggctggtgtg-----
E1B9B3_BCL2L10-01      cagctg--------------gtctggtttttcctctcatactgga-----
F1MV39_BCL2L10-01      cagctg--------------gtctggtttttcctcgcatactgga-----
F6R2C4_BCL2-01         ctcctggctgtctctgaaggcactgctcagtctggccctggtggg-----
O02718_BCL2-01         ctcctggctgtctctgaaggcactgctcagtctggccctggtggg-----
Q05KI8_BCL2L2-01       gaactg--ggcttcagtgaggacagtgctgacgggggctgtggcactggg
Q1RMX3_BCL2L2-01       gaactg--ggcttcagtgaggacagtgctgacgggggctgtggcactggg
A5PJR2_MCL1-01         gaaatg--tgctgctg--------gcttttgcaggtgttgccgga-----
F1MQX4_MCL1-01         gaaatg--tgctgctg--------gcttttgcaggtgttgccgga-----
                            *                                *   *       

Q3C2I0_BCL2A1-01       ------aagatctgtgaaacattatgtcg------cctgaagcaatacta
Q05KJ0_BCL2L1-01       -------gttctgctgggctcgctcttca-----gtcggaaatga-----
E1B9B3_BCL2L10-01      --cagcaataatcataatctact-tctgg--------ataaaattatcag
F1MV39_BCL2L10-01      --cagcaataatcataatctact-tctgg--------ataaaatta----
F6R2C4_BCL2-01         cgcttgcatcaccctgggtgcctatctgg-----gccataagtga-----
O02718_BCL2-01         cgcttgcatcaccctgggtgcctatctgg-----gccataag--------
Q05KI8_BCL2L2-01       ggccctggtaactgtaggggccttttttg-----ctagcaagtga-----
Q1RMX3_BCL2L2-01       ggccctggtaactgtaggggccttttttg-----ctagcaagtga-----
A5PJR2_MCL1-01         -------------gtaggagctggtttggcatatctaataagatag----
F1MQX4_MCL1-01         -------------gtaggagctggtttggcatatctaataagatag----
                                     *           *            **         

Q3C2I0_BCL2A1-01       ttga----------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
E1B9B3_BCL2L10-01      ccaacatggacccagccaagcttgtcagcagccaggggaataacatctgt
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------------------------------------------
O02718_BCL2-01         --------------------------------------------------
Q05KI8_BCL2L2-01       --------------------------------------------------
Q1RMX3_BCL2L2-01       --------------------------------------------------
A5PJR2_MCL1-01         --------------------------------------------------
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       ---------------------
Q05KJ0_BCL2L1-01       ---------------------
E1B9B3_BCL2L10-01      gtggataaaaagccagcctag
F1MV39_BCL2L10-01      ---------------------
F6R2C4_BCL2-01         ---------------------
O02718_BCL2-01         ---------------------
Q05KI8_BCL2L2-01       ---------------------
Q1RMX3_BCL2L2-01       ---------------------
A5PJR2_MCL1-01         ---------------------
F1MQX4_MCL1-01         ---------------------
                                            

© 1998-2018