Dataset for CDS BCL-2-like of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
Q05KJ0_BCL2L1-02       --------------------------------------------------
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------------------------------------------
O02718_BCL2-01         --------------------------------------------------
Q05KI8_BCL2L2-01       --------------------------------------------------
Q1RMX3_BCL2L2-01       --------------------------------------------------
A5PJR2_MCL1-01         atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgg
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
Q05KJ0_BCL2L1-02       --------------------------------------------------
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------------------------------------------
O02718_BCL2-01         --------------------------------------------------
Q05KI8_BCL2L2-01       --------------------------------------------------
Q1RMX3_BCL2L2-01       --------------------------------------------------
A5PJR2_MCL1-01         gggagccggattaggacagggcagcggcgcctcctctccgggggggcggc
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
Q05KJ0_BCL2L1-02       --------------------------------------------------
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------------------------------------------
O02718_BCL2-01         --------------------------------------------------
Q05KI8_BCL2L2-01       --------------------------------------------------
Q1RMX3_BCL2L2-01       --------------------------------------------------
A5PJR2_MCL1-01         ttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggg
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
Q05KJ0_BCL2L1-02       --------------------------------------------------
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------------------------------------------
O02718_BCL2-01         --------------------------------------------------
Q05KI8_BCL2L2-01       --------------------------------------------------
Q1RMX3_BCL2L2-01       --------------------------------------------------
A5PJR2_MCL1-01         gaagccggcacggtgattggcggaagcgccggcccgagccccccggccac
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
Q05KJ0_BCL2L1-02       --------------------------------------------------
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------------------------------------------
O02718_BCL2-01         --------------------------------------------------
Q05KI8_BCL2L2-01       --------------------------------------------------
Q1RMX3_BCL2L2-01       --------------------------------------------------
A5PJR2_MCL1-01         tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
Q05KJ0_BCL2L1-02       --------------------------------------------------
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------------------------------------------
O02718_BCL2-01         --------------------------------------------------
Q05KI8_BCL2L2-01       --------------------------------------------------
Q1RMX3_BCL2L2-01       --------------------------------------------------
A5PJR2_MCL1-01         agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       ---------------------------atgac------------------
Q05KJ0_BCL2L1-01       ---------------------------atgtc------------------
Q05KJ0_BCL2L1-02       ---------------------------atgtc------------------
E1B9B3_BCL2L10-01      ---------------------------atgac------------------
F1MV39_BCL2L10-01      ---------------------------gttgc------------------
F6R2C4_BCL2-01         ---------------------------atggcg-----------------
O02718_BCL2-01         ---------------------------atggcg-----------------
Q05KI8_BCL2L2-01       ---------------------------atggcgaccccagcctcggcccc
Q1RMX3_BCL2L2-01       ---------------------------atggcgaccccagcctcggcccc
A5PJR2_MCL1-01         acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
F1MQX4_MCL1-01         -----------------------------ggaat-----------gttgc
                                                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
Q05KJ0_BCL2L1-02       --------------------------------------------------
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         ---cacgcggggggaa----------------------------------
O02718_BCL2-01         ---cacgcggggggaa----------------------------------
Q05KI8_BCL2L2-01       agacacacgggctctagtgg------------------------------
Q1RMX3_BCL2L2-01       agacacacgggctctagtgg------------------------------
A5PJR2_MCL1-01         catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
F1MQX4_MCL1-01         caatatttt-----------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
Q05KJ0_BCL2L1-02       --------------------------------------------------
E1B9B3_BCL2L10-01      --------------------------------------------------
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------------------------------------------
O02718_BCL2-01         --------------------------------------------------
Q05KI8_BCL2L2-01       --------------------------------------------------
Q1RMX3_BCL2L2-01       --------------------------------------------------
A5PJR2_MCL1-01         ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagt
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       --------------------tgacactgagttt-----------------
Q05KJ0_BCL2L1-01       --------------tcagagtaaccgggagctggtggttgactttctctc
Q05KJ0_BCL2L1-02       --------------tcagagtaaccgggagctggtggttgactttctctc
E1B9B3_BCL2L10-01      -----------------tgaaggc---ggagccatggtg-----gacccg
F1MV39_BCL2L10-01      -----------------tgatggacaggaaagcctggt------------
F6R2C4_BCL2-01         ----------caggctacgataaccgagagatcgtgatgaagtacatcca
O02718_BCL2-01         ----------caggctacgataaccgagagatcgtgatgaagtacatcca
Q05KI8_BCL2L2-01       ----------cagactttgtgggc--------------------------
Q1RMX3_BCL2L2-01       ----------cagactttgtgggc--------------------------
A5PJR2_MCL1-01         aacaacagtccaggctcggacggctcgctgccctcgacgccg--ccccca
F1MQX4_MCL1-01         --------------------------------------------------
                                                                         

Q3C2I0_BCL2A1-01       ------ggctacgttcacgggctggctgaggactatct-----------g
Q05KJ0_BCL2L1-01       ttacaagctttcccagaaaggatacagctggagtcagtttagtgatgtgg
Q05KJ0_BCL2L1-02       ttacaagctttcccagaaaggatacagctggagtcagtttagtgatgtgg
E1B9B3_BCL2L10-01      tttagggagcgcaccgcccggctgctgatggactacct-----------g
F1MV39_BCL2L10-01      -----ggagcgcaccgcccggctgctgatggactacct-----------g
F6R2C4_BCL2-01         ctataagctgtcgcagcggggctacgagtg-ggatgcc-----------g
O02718_BCL2-01         ctataagctgtcgcagcggggctacgagtg-ggatgcc-----------g
Q05KI8_BCL2L2-01       -tataagctgaggcagaaggggtatgtttg-------t-----------g
Q1RMX3_BCL2L2-01       -tataagctgaggcagaaggggtatgtttg-------t-----------g
A5PJR2_MCL1-01         gcagaggaggaggaggacgagttatatcggcagtccct-----------g
F1MQX4_MCL1-01         -cagaggaggaggaggacgagttatattggcagtccct-----------g
                             *             * *      *                   *

Q3C2I0_BCL2A1-01       aaatatgtgttgcagatacagcaacctggatcca---agccaagcaaaac
Q05KJ0_BCL2L1-01       aagagaacagaactg----aggccccagaaggga-----cagaatcagat
Q05KJ0_BCL2L1-02       aagagaacagaactg----aggccccagaaggga-----cagaatcagat
E1B9B3_BCL2L10-01      gagttc-------------tgcgcccgggagccgggcactccagct----
F1MV39_BCL2L10-01      gagttc-------------tgcgcccgggagccgggcactccagct----
F6R2C4_BCL2-01         gagacgcgggcgccg----cgccccccggggccg--ctcccgcgccgggc
O02718_BCL2-01         gagacgcgggcgccg----cgccccccggggccg--ctcccgcgccgggc
Q05KI8_BCL2L2-01       gagctggccccgggg----agggcccagcagctgacccgctacaccaag-
Q1RMX3_BCL2L2-01       gagctggccccgggg----agggcccagcagctgacccgctacaccaag-
A5PJR2_MCL1-01         gagataatctctcag----tacctccgggagcaggcaaccggcgccaagg
F1MQX4_MCL1-01         gagattatctctcgg----tacctccgggagcaggcaaccggcgccaagg
                        *                      ** *                      

Q3C2I0_BCL2A1-01       at--------------------------------ccagggtgttacaa--
Q05KJ0_BCL2L1-01       atggaaacccccagtgccatcaatggcaacgcatcctggcacctggcgga
Q05KJ0_BCL2L1-02       atggaaacccccagtgccatcaatggcaacgcatcctggcacctggcgga
E1B9B3_BCL2L10-01      ----------------------------------cctgcgccgtcca---
F1MV39_BCL2L10-01      ----------------------------------cctgcgccgtcca---
F6R2C4_BCL2-01         atcctgtcctcccagcc-------gggccgcacacccgcgccctccagga
O02718_BCL2-01         atcctgtcctcccagcc-------gggccgcacacccgccccctccagga
Q05KI8_BCL2L2-01       -----------ccatgc-------ggg------------------cag--
Q1RMX3_BCL2L2-01       -----------ccatgc-------ggg------------------cag--
A5PJR2_MCL1-01         acgcgaagcccctgggc-------ggg-------tctgggaccacaag--
F1MQX4_MCL1-01         atgtgaagcccctgggc-------ggg-------tctggggccaccag--
                                                                         

Q3C2I0_BCL2A1-01       -------gatgtggcttcctctgtcc-----------aggacgaa-gtgg
Q05KJ0_BCL2L1-01       tagccctgctgtgaatggagccactggccacagcagaagctcggatgccc
Q05KJ0_BCL2L1-02       tagccctgctgtgaatggagccactggccacagcagaagctcggatgccc
E1B9B3_BCL2L10-01      -----cgcctgaggctgccgtgctgcgccacgtggc-cgcacgta-tcca
F1MV39_BCL2L10-01      -----cgcctgaggctgccgtgctgcgccacgtggc-cgcacgta-tcca
F6R2C4_BCL2-01         cctccccgccgccgcccccggccgccgccgccgggcctgcgccca-gccc
O02718_BCL2-01         cctccccgccgccgcccccggccgccgccgccgggcctgcgccca-gccc
Q05KI8_BCL2L2-01       -----ctggagatgagttcgagacccgcttccgg---cgcacctt-ctcc
Q1RMX3_BCL2L2-01       -----ctggagatgagttcgagacccgcttccgg---cgcacctt-ctcc
A5PJR2_MCL1-01         -----ccgga-aggcgttggagaccc-----------tgcgccga-gtcg
F1MQX4_MCL1-01         -----ccgga-aggcgttggagaccc-----------tgcaccga-gtcg
                                                             *  *        

Q3C2I0_BCL2A1-01       aaaggactct---------------gaagcagtgcttg-gataagtttga
Q05KJ0_BCL2L1-01       gggaagtgatccccatggcagcggtgaagcaagccctgagggaggcaggc
Q05KJ0_BCL2L1-02       gggaagtgatccccatggcagcggtgaagcaagccctgagggaggcaggc
E1B9B3_BCL2L10-01      gga------------------------agcaaatc-------------ga
F1MV39_BCL2L10-01      gga------------------------agcaaatc-------------ga
F6R2C4_BCL2-01         ggtgccgcct----------gtggtgcacctgaccctgcgccaggccggc
O02718_BCL2-01         ggtgccgcct----------gtggtgcacctgaccctgcgccaggccggc
Q05KI8_BCL2L2-01       gat-----ct----------g----gcagctcagct--------gcatgt
Q1RMX3_BCL2L2-01       gat-----ct----------g----gcagctcagct--------gcatgt
A5PJR2_MCL1-01         ggg-----at----------ggggtgcagcgcaac----------cacga
F1MQX4_MCL1-01         ggg-----at----------ggggtgcagcacaac----------cacga
                                                  * *    *             * 

Q3C2I0_BCL2A1-01       tgtggtgtccgtagacactgccagaacaat--------------------
Q05KJ0_BCL2L1-01       gatgagttt---gaactgaggtaccgacgggcattcagcgacctgacgtc
Q05KJ0_BCL2L1-02       gatgagttt---gaactgaggtaccgacgggcattcagcgacctgacgtc
E1B9B3_BCL2L10-01      aacgtcttgcccctataccgccgctgccgcagg--------------cac
F1MV39_BCL2L10-01      aatgtcttgcccctataccgccgctgccgcagg--------------cac
F6R2C4_BCL2-01         gatgacttctctcggc---gctaccgccgcgacttcgccgagatgtccag
O02718_BCL2-01         gatgacttctctcggc---gctaccgccgcgacttcgccgagatgtccag
Q05KI8_BCL2L2-01       gac------cccgggct-cggcccagcaac--------------------
Q1RMX3_BCL2L2-01       gac------cccgggct-cggcccagcaac--------------------
A5PJR2_MCL1-01         gacggctttccaaggca-tgcttcggaaactggacatcaaaaatgaagac
F1MQX4_MCL1-01         gacggctttccaaggca-tgcttcagaaactggacatcaaaaacgaagac
                                          *                              

Q3C2I0_BCL2A1-01       ---attcaacca---------------------------------agtga
Q05KJ0_BCL2L1-01       ccagctccacatcaccccagggacagcatatcagagctttgaacaggtag
Q05KJ0_BCL2L1-02       ccagctccacatcaccccagggacagcatatcagagctttgaacaggtag
E1B9B3_BCL2L10-01      cgcgtcgagctggtggccag-------------------------gatgg
F1MV39_BCL2L10-01      cgcgtcgagctggtggccag-------------------------gatgg
F6R2C4_BCL2-01         tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtgg
O02718_BCL2-01         tcagctgcacctgacgcccttcaccgcgagggaacgcttcgccacggtgg
Q05KI8_BCL2L2-01       ---gcttcacccaggtctct-------------------------gatga
Q1RMX3_BCL2L2-01       ---gcttcacccaggtctct-------------------------gatga
A5PJR2_MCL1-01         gatgtcaaatctttgtctcg-------------------------agtga
F1MQX4_MCL1-01         gatgttaaatctttgtctcg-------------------------agtga
                                                                      *  

Q3C2I0_BCL2A1-01       tggaaaaggaatttgaagatggcattgt---taactggggcaggattgta
Q05KJ0_BCL2L1-01       tgaatgaactcttccgggacgg---ggt---gaactggggtcgcattgtg
Q05KJ0_BCL2L1-02       tgaatgaactcttccgggacgg---ggt---gaactggggtcgcattgtg
E1B9B3_BCL2L10-01      cgcagaggctactcgacgaagaccctggccccagctggggccgcgtggcc
F1MV39_BCL2L10-01      cgcagaggctactcgacgaagaccctggccccagctggggccgcgtggcc
F6R2C4_BCL2-01         tggaggagctcttcagggacgg---ggt---gaactgggggcgcatcgtg
O02718_BCL2-01         tggaggagctcttcagggacgg---ggt---gaactgggggcgcatcgtg
Q05KI8_BCL2L2-01       ------actcttccaa----gg---gggccccaactggggccgccttgtg
Q1RMX3_BCL2L2-01       ------actcttccaa----gg---gggccccaactggggccgccttgtg
A5PJR2_MCL1-01         tggttcatgttttcagtgacgg---agtaacaaactggggcaggattgtg
F1MQX4_MCL1-01         tggttcatgttttcagtgacag---agtaacaaactggggcaggattgtg
                                                 *     * ******  *  * *  

Q3C2I0_BCL2A1-01       accatattcgcctttgaaggtattcttaccaagaaacttctg--------
Q05KJ0_BCL2L1-01       gcctttttctccttcggtggggcactgtgc-----------gt-------
Q05KJ0_BCL2L1-02       gcctttttctccttcggtggggcactgtgc-----------gt-------
E1B9B3_BCL2L10-01      tcactcgtaaccttcgcggggtcgctgctggagaggccaccgcagacgac
F1MV39_BCL2L10-01      tcactcgtgaccttcgcggggtcgctgctggagaggccgccgcagactac
F6R2C4_BCL2-01         gccttctttgagttcggaggggtcatgtgt-----------gt-------
O02718_BCL2-01         gccttctttgagttcggaggggtcatgtgt-----------gt-------
Q05KI8_BCL2L2-01       gccttctttgtctttggagccgcgttgtgt-----------gc-------
Q1RMX3_BCL2L2-01       gccttctttgtctttggagccgcgttgtgt-----------gc-------
A5PJR2_MCL1-01         actcttatttcttttggtgc--ctttgtgg-----------ccaaacact
F1MQX4_MCL1-01         actcttatttcttttggtgc--ctttgtgg-----------ccaaacact
                        *  *  *    ** *  *      *                        

Q3C2I0_BCL2A1-01       -ggcaagtgtattgcctcag------acatggacatgtgcaaggacattt
Q05KJ0_BCL2L1-01       -ggaaagcgtagacaaggag------atgcaggtattggtgagtcggatc
Q05KJ0_BCL2L1-02       -ggaaagcgtagacaaggag------atgcaggtattggtgagtcggatc
E1B9B3_BCL2L10-01      ccgacggcaggagaagagagacg---acgacggcgttagcagggactgtc
F1MV39_BCL2L10-01      ccgacggc---agaagagagacg---acgacggcgttagcagggactgtc
F6R2C4_BCL2-01         -ggagagcgtcaaccgggag------atgtcgcccctggtggacagcatc
O02718_BCL2-01         -ggagagcgtcaaccgggag------atgtcgcccctggtggacagcatc
Q05KI8_BCL2L2-01       -tgagagtgtcaacaaggag------atggagccacttgtgggacaagtg
Q1RMX3_BCL2L2-01       -tgagagtgtcaacaaggag------atggagccacttgtgggacaagtg
A5PJR2_MCL1-01         tgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcat-
F1MQX4_MCL1-01         ttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcat-
                             *           *       *           *         * 

Q3C2I0_BCL2A1-01       ctttctttgtggcggagttc---------atcaccgaaaatacaggagag
Q05KJ0_BCL2L1-01       gcaacttggatggccactta-------c-ctgaatgaccacctagagcct
Q05KJ0_BCL2L1-02       gcaacttggatggccactta-------c-ctgaatgaccacctagagcct
E1B9B3_BCL2L10-01      ggctcctggtggcccttctgtgtgctcagttctgcgaaaggcaccgcgcc
F1MV39_BCL2L10-01      ggctcctggtggcccttctgtgtgctcagttctgcgaaaggcaccgcgcc
F6R2C4_BCL2-01         gccctgtggatgaccgagta-------c-ctgaaccggcacctgcacacc
O02718_BCL2-01         gccctgtggatgaccgagta-------c-ctgaaccggcacctgcacacc
Q05KI8_BCL2L2-01       caggagtggatggtggccta-------c-ctggagacgaggctggctgac
Q1RMX3_BCL2L2-01       caggagtggatggtggccta-------c-ctggagacgaggctggctgac
A5PJR2_MCL1-01         ----cacagatgttctcgta-------aggtcaaaacga--------gac
F1MQX4_MCL1-01         ----cacagatgttctcgta-------aggtcaaaacga--------gac
                               *  *      *           *                   

Q3C2I0_BCL2A1-01       tggataaagcaaaatggaggctg---------------------------
Q05KJ0_BCL2L1-01       tggatccaggagaacggcggctg---------------------------
Q05KJ0_BCL2L1-02       tggatccaggagaacggcggctg---------------------------
E1B9B3_BCL2L10-01      tggctgatgactaacggcggctgggtgagcgcgaaggacgcggggctggt
F1MV39_BCL2L10-01      tggctgatggctaacggcggctg---------------------------
F6R2C4_BCL2-01         tggatccaggacaacggaggctg---------------------------
O02718_BCL2-01         tggatccaggacaacggaggctg---------------------------
Q05KI8_BCL2L2-01       tggatccacagcagtgggggctg---------------------------
Q1RMX3_BCL2L2-01       tggatccacagcagtgggggctg---------------------------
A5PJR2_MCL1-01         tggatagtcaaacaaagaggctg---------------------------
F1MQX4_MCL1-01         tggatagtcaaagaaagaggctg---------------------------
                       *** *           * *****                           

Q3C2I0_BCL2A1-01       ----------------------------ggaaaatgggtttgtaaagaag
Q05KJ0_BCL2L1-01       ----------------------------gg---acacttttgtggaactc
Q05KJ0_BCL2L1-02       ----------------------------gg---acacttttgtggaactc
E1B9B3_BCL2L10-01      gggcagcctgggacgcgcccacgctgccgg---atggattt-tgtctctt
F1MV39_BCL2L10-01      ----------------------------gg---atggattt-tgtctctt
F6R2C4_BCL2-01         ----------------------------gg---acgcctttgtggagctg
O02718_BCL2-01         ----------------------------gg---acgcctttgtggagctg
Q05KI8_BCL2L2-01       ----------------------------gg---cggagttcacagctcta
Q1RMX3_BCL2L2-01       ----------------------------gg---cggagttcacagctcta
A5PJR2_MCL1-01         ----------------------------gg---atgggtttgtggagttc
F1MQX4_MCL1-01         ----------------------------gg---atgggtttgtggagttc
                                                   **        **          

Q3C2I0_BCL2A1-01       tttgaaaccaaa--tctggc-------tggctgacttttctggaagttac
Q05KJ0_BCL2L1-01       tacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaa
Q05KJ0_BCL2L1-02       tacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaa
E1B9B3_BCL2L10-01      cttcagccactcattccagc----------ca---tcttgggaaagacag
F1MV39_BCL2L10-01      tttcagccagtcattccagc----------ca---tcttgggaaagacag
F6R2C4_BCL2-01         tat--------ggccctagcat----gcggcc---cctgtttgatttctc
O02718_BCL2-01         tat--------ggccctagcat----gcggcc---cctgtttgatttctc
Q05KI8_BCL2L2-01       tacggggtcggggccctggaggaggcgcggcg---tctgcgggaggggaa
Q1RMX3_BCL2L2-01       tacggggacggggccctggaggaggcgcggcg---tctgcgggaggggaa
A5PJR2_MCL1-01         ttccatgtagaggacctagaag----gcggca---tc---------agaa
F1MQX4_MCL1-01         ttccatgtagaggacctagaag----gcggca---tc---------agaa
                                         *                               

Q3C2I0_BCL2A1-01       aggaaag-atctgtgaaacattatgtcgcctga-------------agca
Q05KJ0_BCL2L1-01       ccgctggttcctgacgggcatgactgtggctgg-------------tgtg
Q05KJ0_BCL2L1-02       ccgctggttcctgacgggcatgactgtggctgg-------------tgtg
E1B9B3_BCL2L10-01      ctg-----gtctgg-tttttcctctcatactggacagcaataatcataat
F1MV39_BCL2L10-01      ctg-----gtctgg-tttttcctcgcatactggacagcaataatcataat
F6R2C4_BCL2-01         ctggctgtctctga-aggcactgctcagtctgg-----------------
O02718_BCL2-01         ctggctgtctctga-aggcactgctcagtctgg-----------------
Q05KI8_BCL2L2-01       ctg--ggcttcagt-gaggacagtgctgacggg-----------------
Q1RMX3_BCL2L2-01       ctg--ggcttcagt-gaggacagtgctgacggg-----------------
A5PJR2_MCL1-01         atg--tgctgctg---------gcttttgcagg-----------------
F1MQX4_MCL1-01         atg--tgctgctg---------gcttttgcagg-----------------
                         *       * *                * *                  

Q3C2I0_BCL2A1-01       atactattga----------------------------------------
Q05KJ0_BCL2L1-01       gttctgctggg-------ctcgctcttcagtcggaaatga----------
Q05KJ0_BCL2L1-02       gttctgctggg-------ctcgctcttcagtcggaaatga----------
E1B9B3_BCL2L10-01      ctacttctgga--------taaaattatcgtgagttctaaaattcttatt
F1MV39_BCL2L10-01      ctacttctgga--------taaaattattgtga-----------------
F6R2C4_BCL2-01         -ccctggtggg-----cgcttgcatcaccctgggtgccta----------
O02718_BCL2-01         -ccctggtggg-----cgcttgcatcaccctgggtgccta----------
Q05KI8_BCL2L2-01       -ggctgtggcactgggggccctggtaactgtaggggcctt----------
Q1RMX3_BCL2L2-01       -ggctgtggcactgggggccctggtaactgtaggggcctt----------
A5PJR2_MCL1-01         -tgttgccgga------------------gtaggagctgg----------
F1MQX4_MCL1-01         -tgttgccgga------------------gtaggagctgg----------
                           *   *                                         

Q3C2I0_BCL2A1-01       --------------------------------------------------
Q05KJ0_BCL2L1-01       --------------------------------------------------
Q05KJ0_BCL2L1-02       --------------------------------------------------
E1B9B3_BCL2L10-01      tctacctgcctaactctgagcaaccaagcaaaattgaaatgtgaaagacc
F1MV39_BCL2L10-01      --------------------------------------------------
F6R2C4_BCL2-01         --------------tctgg-----gccataagtga---------------
O02718_BCL2-01         --------------tctgg-----gccataag------------------
Q05KI8_BCL2L2-01       --------------ttttg-----ctagcaagtga---------------
Q1RMX3_BCL2L2-01       --------------ttttg-----ctagcaagtga---------------
A5PJR2_MCL1-01         --------------tttggcatatctaataagatag--------------
F1MQX4_MCL1-01         --------------tttggcatatctaataagatag--------------
                                                                         

Q3C2I0_BCL2A1-01       -------------------------------------------------
Q05KJ0_BCL2L1-01       -------------------------------------------------
Q05KJ0_BCL2L1-02       -------------------------------------------------
E1B9B3_BCL2L10-01      aaatcagagtaaaccaccttccgagacatttttatctgcattcatgtaa
F1MV39_BCL2L10-01      -------------------------------------------------
F6R2C4_BCL2-01         -------------------------------------------------
O02718_BCL2-01         -------------------------------------------------
Q05KI8_BCL2L2-01       -------------------------------------------------
Q1RMX3_BCL2L2-01       -------------------------------------------------
A5PJR2_MCL1-01         -------------------------------------------------
F1MQX4_MCL1-01         -------------------------------------------------
                                                                        

© 1998-2019