Dataset for CDS BCL-2-like of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A5PJR2_MCL1-01          atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgg
F1MQX4_MCL1-01          --------------------------------------------------
                                                                          

Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A5PJR2_MCL1-01          gggagccggattaggacagggcagcggcgcctcctctccgggggggcggc
F1MQX4_MCL1-01          --------------------------------------------------
                                                                          

Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A5PJR2_MCL1-01          ttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggg
F1MQX4_MCL1-01          --------------------------------------------------
                                                                          

Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A5PJR2_MCL1-01          gaagccggcacggtgattggcggaagcgccggcccgagccccccggccac
F1MQX4_MCL1-01          --------------------------------------------------
                                                                          

Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A5PJR2_MCL1-01          tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
F1MQX4_MCL1-01          --------------------------------------------------
                                                                          

Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A5PJR2_MCL1-01          agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
F1MQX4_MCL1-01          --------------------------------------------------
                                                                          

Q3C2I0_BCL2A1-01        ---------------------------atgac------------------
A0A3Q1LRT3_BCL2L1-      ---------------------------atgtc------------------
Q05KJ0_BCL2L1-02        ---------------------------atgtc------------------
Q05KJ0_BCL2L1-01        ---------------------------atgtc------------------
E1B9B3_BCL2L10-01       ---------------------------atgac------------------
F1MV39_BCL2L10-01       ---------------------------gttgc------------------
F6R2C4_BCL2-01          ---------------------------atggcg-----------------
O02718_BCL2-01          ---------------------------atggcg-----------------
Q05KI8_BCL2L2-01        ---------------------------atggcgaccccagcctcggcccc
Q1RMX3_BCL2L2-01        ---------------------------atggcgaccccagcctcggcccc
A5PJR2_MCL1-01          acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
F1MQX4_MCL1-01          -----------------------------ggaat-----------gttgc
                                                                          

Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
F6R2C4_BCL2-01          ---cacgcggggggaa----------------------------------
O02718_BCL2-01          ---cacgcggggggaa----------------------------------
Q05KI8_BCL2L2-01        agacacacgggctctagtgg------------------------------
Q1RMX3_BCL2L2-01        agacacacgggctctagtgg------------------------------
A5PJR2_MCL1-01          catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
F1MQX4_MCL1-01          caatatttt-----------------------------------------
                                                                          

Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
A5PJR2_MCL1-01          ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagt
F1MQX4_MCL1-01          --------------------------------------------------
                                                                          

Q3C2I0_BCL2A1-01        --------------------tgacactgagttt-----------------
A0A3Q1LRT3_BCL2L1-      --------------tcagagcaatcgggaactagtggttgactttctctc
Q05KJ0_BCL2L1-02        --------------tcagagtaaccgggagctggtggttgactttctctc
Q05KJ0_BCL2L1-01        --------------tcagagtaaccgggagctggtggttgactttctctc
E1B9B3_BCL2L10-01       -----------------tgaaggc---ggagccatggtg-----gacccg
F1MV39_BCL2L10-01       -----------------tgatggacaggaaagcctggt------------
F6R2C4_BCL2-01          ----------caggctacgataaccgagagatcgtgatgaagtacatcca
O02718_BCL2-01          ----------caggctacgataaccgagagatcgtgatgaagtacatcca
Q05KI8_BCL2L2-01        ----------cagactttgtgggc--------------------------
Q1RMX3_BCL2L2-01        ----------cagactttgtgggc--------------------------
A5PJR2_MCL1-01          aacaacagtccaggctcggacggctcgctgccctcgacgccg--ccccca
F1MQX4_MCL1-01          --------------------------------------------------
                                                                          

Q3C2I0_BCL2A1-01        ------ggctacgttcacgggctggctgaggactatctgaaata------
A0A3Q1LRT3_BCL2L1-      ttacaagctttcccagaaaggatacagctggagtcagtttagtg------
Q05KJ0_BCL2L1-02        ttacaagctttcccagaaaggatacagctggagtcagtttagtgatgtgg
Q05KJ0_BCL2L1-01        ttacaagctttcccagaaaggatacagctggagtcagtttagtgatgtgg
E1B9B3_BCL2L10-01       tttagggagcgcaccgcccggctgctgatggactacctggagtt------
F1MV39_BCL2L10-01       -----ggagcgcaccgcccggctgctgatggactacctggagtt------
F6R2C4_BCL2-01          ctataagctgtcgcagcggggctacgagtg-ggatgccggagac------
O02718_BCL2-01          ctataagctgtcgcagcggggctacgagtg-ggatgccggagac------
Q05KI8_BCL2L2-01        -tataagctgaggcagaaggggtatgtttg-------tggagct------
Q1RMX3_BCL2L2-01        -tataagctgaggcagaaggggtatgtttg-------tggagct------
A5PJR2_MCL1-01          gcagaggaggaggaggacgagttatatcggcagtccctggagat------
F1MQX4_MCL1-01          -cagaggaggaggaggacgagttatattggcagtccctggagat------
                              *             * *      *          *         

Q3C2I0_BCL2A1-01        ------------------------------------------------tg
A0A3Q1LRT3_BCL2L1-      -----------------------------------tcagatatggaaacc
Q05KJ0_BCL2L1-02        aagagaacagaactgaggccccagaagggacagaatcagatatggaaacc
Q05KJ0_BCL2L1-01        aagagaacagaactgaggccccagaagggacagaatcagatatggaaacc
E1B9B3_BCL2L10-01       ---------------------------------------------c----
F1MV39_BCL2L10-01       ---------------------------------------------c----
F6R2C4_BCL2-01          ---------------------------------------------gcggg
O02718_BCL2-01          ---------------------------------------------gcggg
Q05KI8_BCL2L2-01        ---------------------------------------------ggccc
Q1RMX3_BCL2L2-01        ---------------------------------------------ggccc
A5PJR2_MCL1-01          ---------------------------------------------aatct
F1MQX4_MCL1-01          ---------------------------------------------tatct
                                                                          

Q3C2I0_BCL2A1-01        tgttgcagatacagcaacctggatcc---aagccaagca-----------
A0A3Q1LRT3_BCL2L1-      cccagtg-gatcagtggcaacccatcctggcacctggcagatagccccac
Q05KJ0_BCL2L1-02        cccagtgccatcaatggcaacgcatcctggcacctggcggatagccctgc
Q05KJ0_BCL2L1-01        cccagtgccatcaatggcaacgcatcctggcacctggcggatagccctgc
E1B9B3_BCL2L10-01       -----tgcgcccgggagccgggcactc--cagct----------------
F1MV39_BCL2L10-01       -----tgcgcccgggagccgggcactc--cagct----------------
F6R2C4_BCL2-01          cgccgcgccccccggggccg--ctccc--gcgccgggcatcctgtcctcc
O02718_BCL2-01          cgccgcgccccccggggccg--ctccc--gcgccgggcatcctgtcctcc
Q05KI8_BCL2L2-01        cggggagggcccagcagctgacccgct--acaccaag------------c
Q1RMX3_BCL2L2-01        cggggagggcccagcagctgacccgct--acaccaag------------c
A5PJR2_MCL1-01          ctcagtacctccgggagcaggcaaccg--gcgccaaggacgcgaagcccc
F1MQX4_MCL1-01          ctcggtacctccgggagcaggcaaccg--gcgccaaggatgtgaagcccc
                                   *     *              *                 

Q3C2I0_BCL2A1-01        -------------------aaacatccagggtgttacaagatgtggcttc
A0A3Q1LRT3_BCL2L1-      agtgaatggagc-------cactggcca--------cagca-gaagc-tt
Q05KJ0_BCL2L1-02        tgtgaatggagc-------cactggcca--------cagca-gaagc-tc
Q05KJ0_BCL2L1-01        tgtgaatggagc-------cactggcca--------cagca-gaagc-tc
E1B9B3_BCL2L10-01       ---------------cctgcgccgtcca--------cgcct-gaggctgc
F1MV39_BCL2L10-01       ---------------cctgcgccgtcca--------cgcct-gaggctgc
F6R2C4_BCL2-01          cagccgggccgcacacccgcgccctccaggacctccccgcc-gccgcccc
O02718_BCL2-01          cagccgggccgcacacccgccccctccaggacctccccgcc-gccgcccc
Q05KI8_BCL2L2-01        catgcggg------------------cag-------ctgga-gatgagtt
Q1RMX3_BCL2L2-01        catgcggg------------------cag-------ctgga-gatgagtt
A5PJR2_MCL1-01          tgggcggg-------tctgggaccacaag-------ccgga--aggcgtt
F1MQX4_MCL1-01          tgggcggg-------tctggggccaccag-------ccgga--aggcgtt
                                                   *        *        *    

Q3C2I0_BCL2A1-01        ctctgtccaggacgaagt-ggaaaggactc---------------tgaag
A0A3Q1LRT3_BCL2L1-      ggatgcccggaaaatgatccccatga-------------caacagtaaag
Q05KJ0_BCL2L1-02        ggatgcccgggaagtgatccccatgg-------------cagcggtgaag
Q05KJ0_BCL2L1-01        ggatgcccgggaagtgatccccatgg-------------cagcggtgaag
E1B9B3_BCL2L10-01       cgtgctgcgccacgtggc-cgcacgtatccagga--------------ag
F1MV39_BCL2L10-01       cgtgctgcgccacgtggc-cgcacgtatccagga--------------ag
F6R2C4_BCL2-01          cggccgccgccgccgggcctgcgcccagcccggtgccgcctgtggtgcac
O02718_BCL2-01          cggccgccgccgccgggcctgcgcccagcccggtgccgcctgtggtgcac
Q05KI8_BCL2L2-01        cgagacccgcttccgg---cgcaccttctccgat-----ctg----gcag
Q1RMX3_BCL2L2-01        cgagacccgcttccgg---cgcaccttctccgat-----ctg----gcag
A5PJR2_MCL1-01          ggagaccc-----------tgcgccgagtcgggg-----atggggtgcag
F1MQX4_MCL1-01          ggagaccc-----------tgcaccgagtcgggg-----atggggtgcag
                               *                                        * 

Q3C2I0_BCL2A1-01        cagtgcttg-gataagtttgatgtggtgtccgtagacactgccagaacaa
A0A3Q1LRT3_BCL2L1-      caagccctgagggaggcaagcaatgagttt---aaactgaggtaccaaca
Q05KJ0_BCL2L1-02        caagccctgagggaggcaggcgatgagttt---gaactgaggtaccgacg
Q05KJ0_BCL2L1-01        caagccctgagggaggcaggcgatgagttt---gaactgaggtaccgacg
E1B9B3_BCL2L10-01       caaatc-------------gaaacgtcttgcccctataccgccgctgccg
F1MV39_BCL2L10-01       caaatc-------------gaaatgtcttgcccctataccgccgctgccg
F6R2C4_BCL2-01          ctgaccctgcgccaggccggcgatgacttctctcggc---gctaccgccg
O02718_BCL2-01          ctgaccctgcgccaggccggcgatgacttctctcggc---gctaccgccg
Q05KI8_BCL2L2-01        ctcagct--------gcatgtgac------cccgggct-cggcccagcaa
Q1RMX3_BCL2L2-01        ctcagct--------gcatgtgac------cccgggct-cggcccagcaa
A5PJR2_MCL1-01          cgcaac----------cacgagacggctttccaaggca-tgcttcggaaa
F1MQX4_MCL1-01          cacaac----------cacgagacggctttccaaggca-tgcttcagaaa
                        *    *             *                    *         

Q3C2I0_BCL2A1-01        ta------------------------------------------------
A0A3Q1LRT3_BCL2L1-      gacattcagcgacctgatgtcccagctccgcatcaccccagggacagcat
Q05KJ0_BCL2L1-02        ggcattcagcgacctgacgtcccagctccacatcaccccagggacagcat
Q05KJ0_BCL2L1-01        ggcattcagcgacctgacgtcccagctccacatcaccccagggacagcat
E1B9B3_BCL2L10-01       cagg--------------caccgcgtcgagctggtggccag---------
F1MV39_BCL2L10-01       cagg--------------caccgcgtcgagctggtggccag---------
F6R2C4_BCL2-01          cgacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcga
O02718_BCL2-01          cgacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcga
Q05KI8_BCL2L2-01        c-----------------------gcttcacccaggtctct---------
Q1RMX3_BCL2L2-01        c-----------------------gcttcacccaggtctct---------
A5PJR2_MCL1-01          ctggacatcaaaaatgaagacgatgtcaaatctttgtctcg---------
F1MQX4_MCL1-01          ctggacatcaaaaacgaagacgatgttaaatctttgtctcg---------
                                                                          

Q3C2I0_BCL2A1-01        --------ttcaaccaagtgatggaaaaggaatttgaagatggcattgt-
A0A3Q1LRT3_BCL2L1-      gtcagagctttgaacaggtaataaatgaactcttccgggacag---ggt-
Q05KJ0_BCL2L1-02        atcagagctttgaacaggtagtgaatgaactcttccgggacgg---ggt-
Q05KJ0_BCL2L1-01        atcagagctttgaacaggtagtgaatgaactcttccgggacgg---ggt-
E1B9B3_BCL2L10-01       ----------------gatggcgcagaggctactcgacgaagaccctggc
F1MV39_BCL2L10-01       ----------------gatggcgcagaggctactcgacgaagaccctggc
F6R2C4_BCL2-01          ggggacgcttcgccacggtggtggaggagctcttcagggacgg---ggt-
O02718_BCL2-01          gggaacgcttcgccacggtggtggaggagctcttcagggacgg---ggt-
Q05KI8_BCL2L2-01        ----------------gatga------actcttccaa----gg---gggc
Q1RMX3_BCL2L2-01        ----------------gatga------actcttccaa----gg---gggc
A5PJR2_MCL1-01          ----------------agtgatggttcatgttttcagtgacgg---agta
F1MQX4_MCL1-01          ----------------agtgatggttcatgttttcagtgacag---agta
                                          *                            *  

Q3C2I0_BCL2A1-01        --taactggggcaggattgtaaccatattcgcctttgaaggtattcttac
A0A3Q1LRT3_BCL2L1-      --gaaatggggtcacgttgtggcctttttctccttcagtgggacactatg
Q05KJ0_BCL2L1-02        --gaactggggtcgcattgtggcctttttctccttcggtggggcactgtg
Q05KJ0_BCL2L1-01        --gaactggggtcgcattgtggcctttttctccttcggtggggcactgtg
E1B9B3_BCL2L10-01       cccagctggggccgcgtggcctcactcgtaaccttcgcggggtcgctgct
F1MV39_BCL2L10-01       cccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgct
F6R2C4_BCL2-01          --gaactgggggcgcatcgtggccttctttgagttcggaggggtcatgtg
O02718_BCL2-01          --gaactgggggcgcatcgtggccttctttgagttcggaggggtcatgtg
Q05KI8_BCL2L2-01        cccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
Q1RMX3_BCL2L2-01        cccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
A5PJR2_MCL1-01          acaaactggggcaggattgtgactcttatttcttttggtgc--ctttgtg
F1MQX4_MCL1-01          acaaactggggcaggattgtgactcttatttcttttggtgc--ctttgtg
                           *  *****     * *   *  *  *    **    *      *   

Q3C2I0_BCL2A1-01        caagaaacttctg---------ggcaagtgtattgcctcag------aca
A0A3Q1LRT3_BCL2L1-      c-----------at--------gaaaagcatagacaaggag------ata
Q05KJ0_BCL2L1-02        c-----------gt--------ggaaagcgtagacaaggag------atg
Q05KJ0_BCL2L1-01        c-----------gt--------ggaaagcgtagacaaggag------atg
E1B9B3_BCL2L10-01       ggagaggccaccgcagacgacccgacggcaggagaagagagacg---acg
F1MV39_BCL2L10-01       ggagaggccgccgcagactacccgacggc---agaagagagacg---acg
F6R2C4_BCL2-01          t-----------gt--------ggagagcgtcaaccgggag------atg
O02718_BCL2-01          t-----------gt--------ggagagcgtcaaccgggag------atg
Q05KI8_BCL2L2-01        t-----------gc--------tgagagtgtcaacaaggag------atg
Q1RMX3_BCL2L2-01        t-----------gc--------tgagagtgtcaacaaggag------atg
A5PJR2_MCL1-01          g-----------ccaaacacttgaagagtataaatcaagaaagctgcatc
F1MQX4_MCL1-01          g-----------ccaaacactttaagagtataaatcaagaaagctgcatc
                                                   *           *       *  

Q3C2I0_BCL2A1-01        tggacatgtgcaaggacatttctttctttgtggcggagttc---------
A0A3Q1LRT3_BCL2L1-      cacgtattggtgagtcaggtcacaacttcaacggccactta-------c-
Q05KJ0_BCL2L1-02        caggtattggtgagtcggatcgcaacttggatggccactta-------c-
Q05KJ0_BCL2L1-01        caggtattggtgagtcggatcgcaacttggatggccactta-------c-
E1B9B3_BCL2L10-01       acggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcag
F1MV39_BCL2L10-01       acggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcag
F6R2C4_BCL2-01          tcgcccctggtggacagcatcgccctgtggatgaccgagta-------c-
O02718_BCL2-01          tcgcccctggtggacagcatcgccctgtggatgaccgagta-------c-
Q05KI8_BCL2L2-01        gagccacttgtgggacaagtgcaggagtggatggtggccta-------c-
Q1RMX3_BCL2L2-01        gagccacttgtgggacaagtgcaggagtggatggtggccta-------c-
A5PJR2_MCL1-01          gaaccactagcagaaagcat-----cacagatgttctcgta-------ag
F1MQX4_MCL1-01          gaaccactagcagaaagcat-----cacagatgttctcgta-------ag
                                 *         *            *      *          

Q3C2I0_BCL2A1-01        atcaccgaaaatacaggagagtggataaagcaaaatggaggctg------
A0A3Q1LRT3_BCL2L1-      ctaaataaccacctcaagccttggatccaagagaacggcgggtg------
Q05KJ0_BCL2L1-02        ctgaatgaccacctagagccttggatccaggagaacggcggctg------
Q05KJ0_BCL2L1-01        ctgaatgaccacctagagccttggatccaggagaacggcggctg------
E1B9B3_BCL2L10-01       ttctgcgaaaggcaccgcgcctggctgatgactaacggcggctgggtgag
F1MV39_BCL2L10-01       ttctgcgaaaggcaccgcgcctggctgatggctaacggcggctg------
F6R2C4_BCL2-01          ctgaaccggcacctgcacacctggatccaggacaacggaggctg------
O02718_BCL2-01          ctgaaccggcacctgcacacctggatccaggacaacggaggctg------
Q05KI8_BCL2L2-01        ctggagacgaggctggctgactggatccacagcagtgggggctg------
Q1RMX3_BCL2L2-01        ctggagacgaggctggctgactggatccacagcagtgggggctg------
A5PJR2_MCL1-01          gtcaaaacga--------gactggatagtcaaacaaagaggctg------
F1MQX4_MCL1-01          gtcaaaacga--------gactggatagtcaaagaaagaggctg------
                         *                   *** *           * ** **      

Q3C2I0_BCL2A1-01        -------------------------------------------------g
A0A3Q1LRT3_BCL2L1-      -------------------------------------------------g
Q05KJ0_BCL2L1-02        -------------------------------------------------g
Q05KJ0_BCL2L1-01        -------------------------------------------------g
E1B9B3_BCL2L10-01       cgcgaaggacgcggggctggtgggcagcctgggacgcgcccacgctgccg
F1MV39_BCL2L10-01       -------------------------------------------------g
F6R2C4_BCL2-01          -------------------------------------------------g
O02718_BCL2-01          -------------------------------------------------g
Q05KI8_BCL2L2-01        -------------------------------------------------g
Q1RMX3_BCL2L2-01        -------------------------------------------------g
A5PJR2_MCL1-01          -------------------------------------------------g
F1MQX4_MCL1-01          -------------------------------------------------g
                                                                         *

Q3C2I0_BCL2A1-01        gaaaatgggtttgtaaagaagtttgaaacca--aatctggctg----gct
A0A3Q1LRT3_BCL2L1-      g---acacttttgtggaactctacgaaagcaatacaacaaacgagagcca
Q05KJ0_BCL2L1-02        g---acacttttgtggaactctacgggaacaatgcagcagccgagagccg
Q05KJ0_BCL2L1-01        g---acacttttgtggaactctacgggaacaatgcagcagccgagagccg
E1B9B3_BCL2L10-01       g---atggattt-tgtctcttcttcagccactcattccagc---------
F1MV39_BCL2L10-01       g---atggattt-tgtctctttttcagccagtcattccagc---------
F6R2C4_BCL2-01          g---acgcctttgtggagctgtat--------ggccctagcat----gcg
O02718_BCL2-01          g---acgcctttgtggagctgtat--------ggccctagcat----gcg
Q05KI8_BCL2L2-01        g---cggagttcacagctctatacggggtcggggccctggaggaggcgcg
Q1RMX3_BCL2L2-01        g---cggagttcacagctctatacggggacggggccctggaggaggcgcg
A5PJR2_MCL1-01          g---atgggtttgtggagttcttccatgtagaggacctagaag----gcg
F1MQX4_MCL1-01          g---atgggtttgtggagttcttccatgtagaggacctagaag----gcg
                        *        **                                       

Q3C2I0_BCL2A1-01        gacttttctggaa----gttacaggaaagatctgtgaaacattatgtcgc
A0A3Q1LRT3_BCL2L1-      gaagggccaagagcgtttcaactgctggtccctgac-gacacgactgtgg
Q05KJ0_BCL2L1-02        gaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
Q05KJ0_BCL2L1-01        gaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
E1B9B3_BCL2L10-01       -ca---tcttgggaaagacagctg-----gtctggt-ttttcctctcata
F1MV39_BCL2L10-01       -ca---tcttgggaaagacagctg-----gtctggt-ttttcctcgcata
F6R2C4_BCL2-01          gcc---cctgtttgatttctcctggctgtctctgaa-ggcactgctcagt
O02718_BCL2-01          gcc---cctgtttgatttctcctggctgtctctgaa-ggcactgctcagt
Q05KI8_BCL2L2-01        gcg---tctgcgggaggggaactg--ggcttcagtg-aggacagtgctga
Q1RMX3_BCL2L2-01        gcg---tctgcgggaggggaactg--ggcttcagtg-aggacagtgctga
A5PJR2_MCL1-01          gca---tc---------agaaatg--tgctgctg---------gcttttg
F1MQX4_MCL1-01          gca---tc---------agaaatg--tgctgctg---------gcttttg
                               *               *       * *                

Q3C2I0_BCL2A1-01        ctga-------------agcaatactattga-------------------
A0A3Q1LRT3_BCL2L1-      ctgt-------------ttggcattttcttaattaaacatatatttacca
Q05KJ0_BCL2L1-02        ctgg-------------tgtggttctgctgggct----------------
Q05KJ0_BCL2L1-01        ctgg-------------tgtggttctgctgggct----------------
E1B9B3_BCL2L10-01       ctggacagcaataatcataatctacttctgga------------------
F1MV39_BCL2L10-01       ctggacagcaataatcataatctacttctgga------------------
F6R2C4_BCL2-01          ctgg------------------ccctggtggg------------------
O02718_BCL2-01          ctgg------------------ccctggtggg------------------
Q05KI8_BCL2L2-01        cggg------------------ggctgtggcact----------------
Q1RMX3_BCL2L2-01        cggg------------------ggctgtggcact----------------
A5PJR2_MCL1-01          cagg------------------tgttgccgga------------------
F1MQX4_MCL1-01          cagg------------------tgttgccgga------------------
                        * *                      *                        

Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      aacaacccagcaattgtactcttgagcattta------------------
Q05KJ0_BCL2L1-02        ----------------cgctcttcag------------------------
Q05KJ0_BCL2L1-01        ----------------cgctcttcag------------------------
E1B9B3_BCL2L10-01       -----------taaaattatcgtgagttctaaaattcttatttctacctg
F1MV39_BCL2L10-01       -----------taaaattattgtga-------------------------
F6R2C4_BCL2-01          --------cgcttgcatcaccctgggtgccta------------------
O02718_BCL2-01          --------cgcttgcatcaccctgggtgccta------------------
Q05KI8_BCL2L2-01        -----gggggccctggtaactgtaggggcctt------------------
Q1RMX3_BCL2L2-01        -----gggggccctggtaactgtaggggcctt------------------
A5PJR2_MCL1-01          ---------------------gtaggagctgg------------------
F1MQX4_MCL1-01          ---------------------gtaggagctgg------------------
                                                                          

Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      ------tctgggagatacgcaacattactgtag-----------------
Q05KJ0_BCL2L1-02        --------tcggaaatga--------------------------------
Q05KJ0_BCL2L1-01        --------tcggaaatga--------------------------------
E1B9B3_BCL2L10-01       cctaactctgagcaaccaagcaaaattgaaatgtgaaagaccaaatcaga
F1MV39_BCL2L10-01       --------------------------------------------------
F6R2C4_BCL2-01          ------tctgg-----gccataagtga-----------------------
O02718_BCL2-01          ------tctgg-----gccataag--------------------------
Q05KI8_BCL2L2-01        ------ttttg-----ctagcaagtga-----------------------
Q1RMX3_BCL2L2-01        ------ttttg-----ctagcaagtga-----------------------
A5PJR2_MCL1-01          ------tttggcatatctaataagatag----------------------
F1MQX4_MCL1-01          ------tttggcatatctaataagatag----------------------
                                                                          

Q3C2I0_BCL2A1-01        -----------------------------------------
A0A3Q1LRT3_BCL2L1-      -----------------------------------------
Q05KJ0_BCL2L1-02        -----------------------------------------
Q05KJ0_BCL2L1-01        -----------------------------------------
E1B9B3_BCL2L10-01       gtaaaccaccttccgagacatttttatctgcattcatgtaa
F1MV39_BCL2L10-01       -----------------------------------------
F6R2C4_BCL2-01          -----------------------------------------
O02718_BCL2-01          -----------------------------------------
Q05KI8_BCL2L2-01        -----------------------------------------
Q1RMX3_BCL2L2-01        -----------------------------------------
A5PJR2_MCL1-01          -----------------------------------------
F1MQX4_MCL1-01          -----------------------------------------
                                                                 

© 1998-2019