Dataset for CDS BCL2L2 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q05KI8_BCL2L2-01      atggcgaccccagcctcggccccagacacacgggctctagtggcagactt
Q1RMX3_BCL2L2-01      atggcgaccccagcctcggccccagacacacgggctctagtggcagactt
                      **************************************************

Q05KI8_BCL2L2-01      tgtgggctataagctgaggcagaaggggtatgtttgtggagctggccccg
Q1RMX3_BCL2L2-01      tgtgggctataagctgaggcagaaggggtatgtttgtggagctggccccg
                      **************************************************

Q05KI8_BCL2L2-01      gggagggcccagcagctgacccgctacaccaagccatgcgggcagctgga
Q1RMX3_BCL2L2-01      gggagggcccagcagctgacccgctacaccaagccatgcgggcagctgga
                      **************************************************

Q05KI8_BCL2L2-01      gatgagttcgagacccgcttccggcgcaccttctccgatctggcagctca
Q1RMX3_BCL2L2-01      gatgagttcgagacccgcttccggcgcaccttctccgatctggcagctca
                      **************************************************

Q05KI8_BCL2L2-01      gctgcatgtgaccccgggctcggcccagcaacgcttcacccaggtctctg
Q1RMX3_BCL2L2-01      gctgcatgtgaccccgggctcggcccagcaacgcttcacccaggtctctg
                      **************************************************

Q05KI8_BCL2L2-01      atgaactcttccaagggggccccaactggggccgccttgtggccttcttt
Q1RMX3_BCL2L2-01      atgaactcttccaagggggccccaactggggccgccttgtggccttcttt
                      **************************************************

Q05KI8_BCL2L2-01      gtctttggagccgcgttgtgtgctgagagtgtcaacaaggagatggagcc
Q1RMX3_BCL2L2-01      gtctttggagccgcgttgtgtgctgagagtgtcaacaaggagatggagcc
                      **************************************************

Q05KI8_BCL2L2-01      acttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
Q1RMX3_BCL2L2-01      acttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
                      **************************************************

Q05KI8_BCL2L2-01      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta
Q1RMX3_BCL2L2-01      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta
                      **************************************************

Q05KI8_BCL2L2-01      tacggggtcggggccctggaggaggcgcggcgtctgcgggaggggaactg
Q1RMX3_BCL2L2-01      tacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactg
                      ******* ******************************************

Q05KI8_BCL2L2-01      ggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctgg
Q1RMX3_BCL2L2-01      ggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctgg
                      **************************************************

Q05KI8_BCL2L2-01      taactgtaggggccttttttgctagcaagtga
Q1RMX3_BCL2L2-01      taactgtaggggccttttttgctagcaagtga
                      ********************************

© 1998-2018