Dataset for CDS BCL2L10 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

E1B9B3_BCL2L10-01      ggagccatggtggacccgtttagggagcgcaccgcccggctgctgatgga
F1MV39_BCL2L10-01      ggagccatggtggacccgtttagggagcgcaccgcccggctgctgatgga

E1B9B3_BCL2L10-01      ctacctggagttctgcgcccgggagccgggcactccagctcctgcgccgt
F1MV39_BCL2L10-01      ctacctggagttctgcgcccgggagccgggcactccagctcctgcgccgt

E1B9B3_BCL2L10-01      ccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaa
F1MV39_BCL2L10-01      ccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaa

E1B9B3_BCL2L10-01      gcaaatcgaaacgtcttgcccctataccgccgctgccgcaggcaccgcgt
F1MV39_BCL2L10-01      gcaaatcgaaatgtcttgcccctataccgccgctgccgcaggcaccgcgt
                       *********** **************************************

E1B9B3_BCL2L10-01      cgagctggtggccaggatggcgcagaggctactcgacgaagaccctggcc
F1MV39_BCL2L10-01      cgagctggtggccaggatggcgcagaggctactcgacgaagaccctggcc

E1B9B3_BCL2L10-01      ccagctggggccgcgtggcctcactcgtaaccttcgcggggtcgctgctg
F1MV39_BCL2L10-01      ccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctg
                       **************************** *********************

E1B9B3_BCL2L10-01      gagaggccaccgcagacgacccgacggcaggagaagagagacgacgacgg
F1MV39_BCL2L10-01      gagaggccgccgcagactacccgacggc---agaagagagacgacgacgg
                       ******** ******** **********   *******************

E1B9B3_BCL2L10-01      cgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttct
F1MV39_BCL2L10-01      cgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttct

E1B9B3_BCL2L10-01      gcgaaaggcaccgcgcctggctgatgactaacggcggctgggatggattt
F1MV39_BCL2L10-01      gcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattt
                       ************************** ***********************

E1B9B3_BCL2L10-01      tgtctcttcttcagccactcattccagccatcttgggaaagacagctggt
F1MV39_BCL2L10-01      tgtctctttttcagccagtcattccagccatcttgggaaagacagctggt
                       ******** ******** ********************************

E1B9B3_BCL2L10-01      ctggtttttcctctcatactggacagcaataatcataatctacttctgga
F1MV39_BCL2L10-01      ctggtttttcctcgcatactggacagcaataatcataatctacttctgga
                       ************* ************************************

E1B9B3_BCL2L10-01      taaaattatcagccaacatggacccagccaagcttgtcagcagccagggg
F1MV39_BCL2L10-01      taaaatta------------------------------------------

E1B9B3_BCL2L10-01      aataacatctgtgtggataaaaagccagcctag
F1MV39_BCL2L10-01      ---------------------------------

© 1998-2019