Dataset for CDS BCL-2 of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F6R2C4_BCL2-01      atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccac
O02718_BCL2-01      atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccac

F6R2C4_BCL2-01      tataagctgtcgcagcggggctacgagtgggatgccggagacgcgggcgccgcgcccccc
O02718_BCL2-01      tataagctgtcgcagcggggctacgagtgggatgccggagacgcgggcgccgcgcccccc

F6R2C4_BCL2-01      ggggccgctcccgcgccgggcatcctgtcctcccagccgggccgcacacccgcgccctcc
O02718_BCL2-01      ggggccgctcccgcgccgggcatcctgtcctcccagccgggccgcacacccgccccctcc
                    ***************************************************** ******

F6R2C4_BCL2-01      aggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
O02718_BCL2-01      aggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg

F6R2C4_BCL2-01      cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc
O02718_BCL2-01      cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgc

F6R2C4_BCL2-01      gacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgcttc
O02718_BCL2-01      gacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcgagggaacgcttc
                    **************************************************** *******

F6R2C4_BCL2-01      gccacggtggtggaggagctcttcagggacggggtgaactgggggcgcatcgtggccttc
O02718_BCL2-01      gccacggtggtggaggagctcttcagggacggggtgaactgggggcgcatcgtggccttc

F6R2C4_BCL2-01      tttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
O02718_BCL2-01      tttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg

F6R2C4_BCL2-01      gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccag
O02718_BCL2-01      gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccag

F6R2C4_BCL2-01      gacaacggaggctgggacgcctttgtggagctgtatggccctagcatgcggcccctgttt
O02718_BCL2-01      gacaacggaggctgggacgcctttgtggagctgtatggccctagcatgcggcccctgttt

F6R2C4_BCL2-01      gatttctcctggctgtctctgaaggcactgctcagtctggccctggtgggcgcttgcatc
O02718_BCL2-01      gatttctcctggctgtctctgaaggcactgctcagtctggccctggtgggcgcttgcatc

F6R2C4_BCL2-01      accctgggtgcctatctgggccataagtga
O02718_BCL2-01      accctgggtgcctatctgggccataag---

© 1998-2019