Dataset for CDS MCL-1 of organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B1IEV7_MCL1-01      ---atgaacccaaccgcgatcagcctcctgtgtgacggaacaa-------
A0A3B1K5R1_MCL1-01      atgatgagccca--caggatatgtgttc-gtataacaagaagacggccga
                           **** ****  *  ***  *  * * ** * **   *  *       

A0A3B1IEV7_MCL1-01      -------gcccggttctctacagaaccgagaaagaggagaagctg---cc
A0A3B1K5R1_MCL1-01      cattgttccccgggtcgctgt-tcgcggaggagggggaggagcggggctc
                                ***** ** **      * *** * * **** *** *    *

A0A3B1IEV7_MCL1-01      ccggacgg---agcggccggaacgcggcctggaggggctgcagtccgcta
A0A3B1K5R1_MCL1-01      tcgctcggtctcgcggccgacattagacctaccaggcccggcgtc-----
                         **  ***    *******  *   * ***    ** * *  ***     

A0A3B1IEV7_MCL1-01      aaggagtctccatgggcggcgggtctctgcccgactccccgctggcggac
A0A3B1K5R1_MCL1-01      --------------gacgacggctcagtgcccagctcccccttgtcggac
                                      * ** *** **  *****  ******  ** *****

A0A3B1IEV7_MCL1-01      -----gtagacttcatccaggactttagctgccgctgcccgggcg---cg
A0A3B1K5R1_MCL1-01      tgcggggagat--------ggccgttgggaactgcaagcagtacgaaacg
                             * ***         ** * ** *   * **   * *  **   **

A0A3B1IEV7_MCL1-01      ctggaggcggagacccgc-------------cgcctgatggtggagtttt
A0A3B1K5R1_MCL1-01      ctgga--cggagacacgcgagagattatcagtgactttctgaggaacttt
                        *****  ******* ***              * **    * ***  ***

A0A3B1IEV7_MCL1-01      accgcgggtacctgggccagaagccccgggagcagagcccggccctgcgg
A0A3B1K5R1_MCL1-01      tgcggactctctcggtcctgtg-----gaggacacggtgcggttgtacag
                          **      *  ** ** *       * *  **  *  ***   * * *

A0A3B1IEV7_MCL1-01      accatgagccgggtggtggcgggggtcgtcctcaaacacgggatcgccta
A0A3B1K5R1_MCL1-01      acaatgaagcgggtggtggacgatctggtggtcaaacatgggattgcgta
                        ** ****  **********  *   * **  ******* ***** ** **

A0A3B1IEV7_MCL1-01      caacggtatggtccagaagctgaatttggaggagcaggacgacagtatgg
A0A3B1K5R1_MCL1-01      caaaggtatgttgaacaaactgggtatggaagacagaggagatgacatgt
                        *** ****** *  * ** ***  * **** **    *  **    *** 

A0A3B1IEV7_MCL1-01      acattattagcagcgtagctaaggctctgtttagcgacggaaccacgaac
A0A3B1K5R1_MCL1-01      atgtaattagggcagtagctaaggagctattcagtgatggcatcaccaac
                        *  * *****    **********  ** ** ** ** ** * *** ***

A0A3B1IEV7_MCL1-01      tgggggcggatcgttagcctggtggcgttcggcgcggtggtgtgtgatca
A0A3B1K5R1_MCL1-01      tggggcagggtcgccagcctggtggcctttggagcagtggtgtccaagca
                        *****  ** ***  *********** ** ** ** *******   * **

A0A3B1IEV7_MCL1-01      tctgaagaagaagagtcgagatcactgcgtggagaacgtcgcccaacaca
A0A3B1K5R1_MCL1-01      tcagcatgacatgggccgaggccactgtgtgagtctagtgggtgaagaac
                        ** * *  * * * * ****  ***** ***      ** *   ** *  

A0A3B1IEV7_MCL1-01      tctccacctacctcaacacccaccaacaccagtggctcatcaacaacaac
A0A3B1K5R1_MCL1-01      tatcctcatatcttctgtcagacgaaagggactggctcctaaaaaacaaa
                        * *** * ** **     *  ** **    * ****** * ** ***** 

A0A3B1IEV7_MCL1-01      gcctgggacggattcgtggaattcttccgcgaggacgactcagaatcacg
A0A3B1K5R1_MCL1-01      gcatgggatggctttgtggagttttttcgtgttcctgatcctgagtcaac
                        ** ***** ** ** ***** ** ** ** *     **  * ** ***  

A0A3B1IEV7_MCL1-01      agtccgaaacgccctgatggccttcgctggatttgccgggctgggggcgg
A0A3B1K5R1_MCL1-01      gatgagaaatgcattaatggcctttgttactgtggcaggtcttggagcct
                          *  **** **  * ******** * *    * ** ** ** ** **  

A0A3B1IEV7_MCL1-01      ggctagcactactgatgcgctga
A0A3B1K5R1_MCL1-01      caatagcatttttggcaagataa
                           ***** *  **    * * *

© 1998-2019