Dataset for CDS BCL-2-like of organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5LC19_BCL2L1-01      atgtcgtactataaccgagaattagtggtgtactttattaagtacaaact
W5LHQ4_MCL1-01        ------------gacgacggctcagtg----------------cccagct
                                   **   *  * ****                 * * **

W5LC19_BCL2L1-01      ctcacagaggaactatcctactaatcacatcggactcgtggaagaaacaa
W5LHQ4_MCL1-01        ccc---------------------ccttgtcggactgcggggagatggcc
                      * *                      *   *******   ** ***     

W5LC19_BCL2L1-01      atc--gaactgaagggggccaggaa--gcggaggggaacgcagaggcggc
W5LHQ4_MCL1-01        gttgggaactgcaagcagtacgaaacgctggacggagacacgcgagagat
                       *   ****** * *  *   * **    *** **  ** *    * *  

W5LC19_BCL2L1-01      cg-cggtgactc---------ccaccgcagtcgttaacgggtccgtaaat
W5LHQ4_MCL1-01        tatcagtgactttctgaggaacttttgcggactctctcggtcctgtggag
                         * ******          *    ** * *  *  ***  * **  * 

W5LC19_BCL2L1-01      gggacgagtcacggtgcggcagggtcgcccacctcgtccccccagagaag
W5LHQ4_MCL1-01        ga-------cacggtgcgg--------------ttgtacagacaatgaag
                      *        **********              * ** *   **  ****

W5LC19_BCL2L1-01      ggccaacggggctcgggggctggatgcagtgaaagaggcactgcgggact
W5LHQ4_MCL1-01        -------------cgggtggtgga--------------cgatctggtggt
                                   **** * ****              *  *  **   *

W5LC19_BCL2L1-01      cagccaacgagtttgagctgcgatactctcgcgccttcagcgacctgtcc
W5LHQ4_MCL1-01        caaacatgggatt-------------------gcgtacaaaggtatgttg
                      **  **  *  **                   ** * **  *   ***  

W5LC19_BCL2L1-01      tcccagctgcacat------cacgcctgctactgcgtaccagagctttga
W5LHQ4_MCL1-01        aacaaactgggtatggaagacagaggagatgacatgtatgtaa---ttag
                        * * ***   **      **     * *     ***    *   **  

W5LC19_BCL2L1-01      gagcgtgatggacgaggtgtttcgcgatggcgt---caactggggccgcg
W5LHQ4_MCL1-01        ggcagtagctaaggagctattcagtgatggcatcaccaactggggcaggg
                      *   **     * *** * **  * ****** *   ********** * *

W5LC19_BCL2L1-01      tcgtaggtttgttcgctttcggcggggctctgtgtgtggagtgcgtggag
W5LHQ4_MCL1-01        tcgccagcctggtggcctttggagcagtggtgtccaagcatc------ag
                      ***   *  ** * ** ** ** *  *   ***    * *        **

W5LC19_BCL2L1-01      aaggagatgagcc----ccctggtgggacgcatcgcagagtggatgaccg
W5LHQ4_MCL1-01        catgacatgggccgaggccactgtgtga------gtctagtgggtgaaga
                       * ** *** ***    **   *** **      *   ***** ***   

W5LC19_BCL2L1-01      tctacttggacaaccacatccagcc--------ctggatccaggagcaag
W5LHQ4_MCL1-01        actatcctcatatcttctgtcagacgaaagggactggctcctaaaaaaca
                       ***     * * *  *   *** *        **** ***   *  *  

W5LC19_BCL2L1-01      gaggatgggaacgctttgcagagatctttggga---acgacacagcagca
W5LHQ4_MCL1-01        aagcatgggatggctttgtggagttttttcgtgttcctgatcctgagtca
                       ** ******  ******  *** * *** *       **  * *   **

W5LC19_BCL2L1-01      gagagcagaaggatgcaggaacgctataagatgtggctgctggtggggat
W5LHQ4_MCL1-01        acgatgagaa--atgcattaatg---------------------------
                        **  ****  *****  ** *                           

W5LC19_BCL2L1-01      gaccctgttcacaggaattgtggtgggctctctcatcgctcagaagcgtc
W5LHQ4_MCL1-01        gcctttgtt-------actgtggcagg-tcttggagc-ctcaatagcatt
                      * *  ****       * *****  ** ***   * * ****  *** * 

W5LC19_BCL2L1-01      t--------gtaa
W5LHQ4_MCL1-01        tttggcaagataa
                      *         ***

© 1998-2018