Dataset for CDS MCL-1 of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5DMS4_MCL1-01      atgtttggcttccaa------gtggtaatcagact--caacctctactg-
A0A2K5EPY9_MCL1-01      ---------------aatgcctcatgttccagacctgcatgcttttctt-
A0A2K5EPY9_MCL1-02      ---------------ag-----------ccagagttata---ataactta
A0A2K5C7L5_MCL1-01      atgtttggcctccaaagaaacgcgctaatcggact--caacctctactgt
A0A2K5CFH3_MCL1-03      atgtttggcctccaaagaaacgcggtaatcggact--caacctctactgt
A0A2K5CFH3_MCL1-02      atgtttggcctccaaagaaacgcggtaatcggact--caacctctactgt
A0A2K5CFH3_MCL1-01      atgtttggcctccaaagaaacgcggtaatcggact--caacctctactgt
                                                     * **     *       **  

A0A2K5DMS4_MCL1-01      -----------------------------cggtgccatccctccaggacc
A0A2K5EPY9_MCL1-01      -------cc-----------------------------------------
A0A2K5EPY9_MCL1-02      aagataacc-----------------------------------------
A0A2K5C7L5_MCL1-01      gagtgggccggcttggggactggcagtggcggcaccacccctccgggagg
A0A2K5CFH3_MCL1-03      gggggggccggcttgggggccggcagcggcggcgccacccctccgggagg
A0A2K5CFH3_MCL1-02      gggggggccggcttgggggccggcagcggcggcgccacccctccgggagg
A0A2K5CFH3_MCL1-01      gggggggccggcttgggggccggcagcggcggcgccacccctccgggagg
                                                                          

A0A2K5DMS4_MCL1-01      gcggctttt-----------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggg
A0A2K5CFH3_MCL1-03      gcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggg
A0A2K5CFH3_MCL1-02      gcggctttt-----------------------------------------
A0A2K5CFH3_MCL1-01      gcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggg
                                                                          

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gaggggaggccggcgtggtgattggcggaagcgccggcgctagcccctcg
A0A2K5CFH3_MCL1-03      gaggggaggccggcgcggtgattggcggaagcgccggcgctagccccccg
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      gaggggaggccggcgcggtgattggcggaagcgccggcgctagccccccg
                                                                          

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gccgccctcacgcctgacgcccgg-gggtcgtgcggccgctgc-------
A0A2K5CFH3_MCL1-03      gccgccctcgtgcctgacgcccggagggtcgtgcggccgccgcccattgg
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      gccgccctcgtgcctgacgcccggagggtcgtgcggccgccgcccattgg
                                                                          

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ----------------------------------------tggttcttcg
A0A2K5CFH3_MCL1-03      cgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcg
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      cgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcg
                                                                          

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      cgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgcc
A0A2K5CFH3_MCL1-03      cgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgcc
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      cgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgcc
                                                                          

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      -------------------------------ccaggcatg----------
A0A2K5EPY9_MCL1-02      -------------------------------acatgcatg----------
A0A2K5C7L5_MCL1-01      gacgccatcatgtcgcccgaagaagagctggacaggtacgagccggagcc
A0A2K5CFH3_MCL1-03      gacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcc
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      gacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcc
                                                                          

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      tctcgggaagcggccggctgtcctgcccctgctggagttggtggaggagc
A0A2K5CFH3_MCL1-03      tctcgggaagcggccggctgtcctgcccctgctggagttggtcggggagc
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      tctcgggaagcggccggctgtcctgcccctgctggagttggtcggggagc
                                                                          

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ctggtaatgactccagtacggatgggtcactaccctcgacgccgccgaca
A0A2K5CFH3_MCL1-03      ctggtaatggctccagtacggacgggtcactaccctcgacgccgcctcca
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      ctggtaatggctccagtacggacgggtcactaccctcgacgccgcctcca
                                                                          

A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ---------------------------------tcactggagattatctc
A0A2K5CFH3_MCL1-03      gcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctc
A0A2K5CFH3_MCL1-02      --------------------------------------------------
A0A2K5CFH3_MCL1-01      gcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctc
                                                                          

A0A2K5DMS4_MCL1-01      ------------------ggcgactggcgccaaggacacaaagccaatgg
A0A2K5EPY9_MCL1-01      -------cttcgaaaactg------gacatcaa--aaacaaagacgatg-
A0A2K5EPY9_MCL1-02      -------cttcgaaaactg------gacatcaa--aaacaaagacgatg-
A0A2K5C7L5_MCL1-01      tcggtaccttcgggaacaggcgactggcgccaaggacacaaagccaatgg
A0A2K5CFH3_MCL1-03      tcggtaccttcgggagcaggcgaccggcgccaaggacacaaagccaatgg
A0A2K5CFH3_MCL1-02      ------------------ggcgaccggcgccaaggacacaaagccaatgg
A0A2K5CFH3_MCL1-01      tcggtaccttcgggagcaggcgaccggcgccaaggacacaaagccaatgg
                                          *      * *  ***  * ****** * *** 

A0A2K5DMS4_MCL1-01      gcaggtctgaggccgccaacagtaaggcgctggagaccttacgaggggtt
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      acaggtccggggccgccagcaggaaggctctggagaccttacgacgggtt
A0A2K5CFH3_MCL1-03      gcaggtccggggccgccagcaggaaggcgctggagaccttacgacgggtt
A0A2K5CFH3_MCL1-02      gcaggtccggggccgccagcaggaaggcgctggagaccttacgacgggtt
A0A2K5CFH3_MCL1-01      gcaggtccggggccgccagcaggaaggcgctggagaccttacgacgggtt
                                                                          

A0A2K5DMS4_MCL1-01      ggggaaggcgtgccccgcaaccacgagatggccttacaaggcatgcttcg
A0A2K5EPY9_MCL1-01      ----------------------------------tcaaa-----------
A0A2K5EPY9_MCL1-02      ----------------------------------tcaaa-----------
A0A2K5C7L5_MCL1-01      ggggacggcgtgcagcgcaaccacgagacggccttccaa-----------
A0A2K5CFH3_MCL1-03      ggggacggcgtgcagcgcaaccacgagacggccttccaa-----------
A0A2K5CFH3_MCL1-02      ggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcg
A0A2K5CFH3_MCL1-01      ggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcg
                                                          *  **           

A0A2K5DMS4_MCL1-01      gaatctggacaacaaaaacgaagacaatgtcaaatcttt-----------
A0A2K5EPY9_MCL1-01      ----------------------------------tctttgtctcgagtga
A0A2K5EPY9_MCL1-02      ----------------------------------tctttgtctcgagtga
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      gaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtga
A0A2K5CFH3_MCL1-01      gaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtga
                                                                          

A0A2K5DMS4_MCL1-01      ----------------ctacggcgtaacaaactggggtaggattgtgact
A0A2K5EPY9_MCL1-01      tggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgact
A0A2K5EPY9_MCL1-02      tggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgact
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      tggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgact
A0A2K5CFH3_MCL1-01      tggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgact
                                                                          

A0A2K5DMS4_MCL1-01      ctcagttcttttggtgcctttgtggccaaacacttgaagaccataaacca
A0A2K5EPY9_MCL1-01      ctcatttcttttggtgcctttgtggccaaacacttgaagaccataaacca
A0A2K5EPY9_MCL1-02      ctcatttcttttggtgcctttgtggccaaacacttgaagaccataaacca
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      ctcatttcttttggtgcctttgtggccaaacacttgaagaccataaacca
A0A2K5CFH3_MCL1-01      ctcatttcttttggtgcctttgtggccaaacacttgaagaccataaacca
                                                                          

A0A2K5DMS4_MCL1-01      agaaagttgcatcgaaccattagcagaaagtat--cagatattctc----
A0A2K5EPY9_MCL1-01      agaaagctgcattgaaccattagcagaaagtattacagacgttctcgtaa
A0A2K5EPY9_MCL1-02      agaaagctgcattgaaccattagcagaaagtattacagacgttctcgtaa
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-02      agaaagctgcattgaaccattagcagaaagtatcacagacgttctcgtaa
A0A2K5CFH3_MCL1-01      agaaagctgcattgaaccattagcagaaagtatcacagacgttctcgtaa
                                                                          

A0A2K5DMS4_MCL1-01      ---------------------------------gctgggatgggtttgtg
A0A2K5EPY9_MCL1-01      ggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtg
A0A2K5EPY9_MCL1-02      ggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtg
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      -------------------------------------ggatgggtttgtg
A0A2K5CFH3_MCL1-02      ggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtg
A0A2K5CFH3_MCL1-01      ggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtg
                                                                          

A0A2K5DMS4_MCL1-01      gagttcttccgtgtagaggacttagaaggtggcatcagaaatgggctgct
A0A2K5EPY9_MCL1-01      gagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgct
A0A2K5EPY9_MCL1-02      gagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgct
A0A2K5C7L5_MCL1-01      --gttcttccatgtagaagacctagaaggtggcatcagaaatgtgctgct
A0A2K5CFH3_MCL1-03      gagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgct
A0A2K5CFH3_MCL1-02      gagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgct
A0A2K5CFH3_MCL1-01      gagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgct
                          ******** ****** *** ********************* ******

A0A2K5DMS4_MCL1-01      ggctttcgcaggtgttgctggagtaggaactgatttggca-tatctaata
A0A2K5EPY9_MCL1-01      ggcttttgcatgtgttgctggagtaggagctggtttggca-tatctaata
A0A2K5EPY9_MCL1-02      ggcttttgcatgtgttgctggagtaggagctggtttggca-tatctaata
A0A2K5C7L5_MCL1-01      ggcttttgcaggtgttgctggagtaggagctggtttggca-tatctaata
A0A2K5CFH3_MCL1-03      ggcttttgcaggtgttgctggagtaggagctggtttggc-----------
A0A2K5CFH3_MCL1-02      ggcttttgcaggtgttgctggagtaggagctggtttggcactgtctctt-
A0A2K5CFH3_MCL1-01      ggcttttgcaggtgttgctggagtaggagctggtttggcactgtctctt-
                        ****** *** ***************** *** ******           

A0A2K5DMS4_MCL1-01      agatag--------
A0A2K5EPY9_MCL1-01      agatag--------
A0A2K5EPY9_MCL1-02      agatag--------
A0A2K5C7L5_MCL1-01      agatagccttgtaa
A0A2K5CFH3_MCL1-03      --------------
A0A2K5CFH3_MCL1-02      --atacacatctag
A0A2K5CFH3_MCL1-01      --atacacatctag
                                      

© 1998-2018