Dataset for CDS BCL-2-like of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

16 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      ------------------------------------catctttcatcctt
A0A2K5CWZ4_BCL2L2-      atgccccttctggttctctgtccatatattcatgccagtctttcatcctt
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      -------------------atgacagactg----------tgaatttgga
A0A2K5D2I1_BCL2A1-      -------------------atgacagactg----------tgaatttgga
A0A2K5EBP4_BCL2L1-      ---------------------------------------atgtctcagag
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      -------------------atggcgacccc-----agcctcggccccaga
A0A2K5CWZ4_BCL2L2-      gcctcttatagccgcccggatggcgacccc-----agcctcggccccaga
A0A2K5CWZ4_BCL2L2-      gcctcttatagccgcccggatggcgacccc-----agcctcggccccaga
A0A2K5EB04_BCL2-01      -------------------atggc--gcacgctgggagaacagggtacga
A0A2K5F974_BCL2L10      -------------------atggctgacccgctgcggcagcgcaccg---
A0A2K5DMS4_MCL1-01      -------------------atgtttggctt-ccaa------gtggta---
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      -------------------atgtttggcct-ccaaagaaacgcgcta---
A0A2K5CFH3_MCL1-03      -------------------atgtttggcct-ccaaagaaacgcggta---
A0A2K5CFH3_MCL1-01      -------------------atgtttggcct-ccaaagaaacgcggta---
A0A2K5CFH3_MCL1-02      -------------------atgtttggcct-ccaaagaaacgcggta---

A0A2K5D2I1_BCL2A1-      tatat-------------------------tcacaatctaactcaggact
A0A2K5D2I1_BCL2A1-      tatat-------------------------tcacaatctaactcaggact
A0A2K5EBP4_BCL2L1-      caaccgggagctggtggttgactttctctcctacaagctttcccagaaag
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      cacacgggctctggtggcagactttgtaggttataagctgaggcagaagg
A0A2K5CWZ4_BCL2L2-      cacacgggctctggtggcagactttgtaggttataagctgaggcagaagg
A0A2K5CWZ4_BCL2L2-      cacacgggctctggtggcagactttgtaggttataagctgaggcagaagg
A0A2K5EB04_BCL2-01      taaccgagagatagtgatgaagtacatccactataagctgtcgcagaggg
A0A2K5F974_BCL2L10      -------------------------agcggct------------------
A0A2K5DMS4_MCL1-01      -------------------------atcagactcaacctctact------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      -------------------------atcggactcaacctctactgtgagt
A0A2K5CFH3_MCL1-03      -------------------------atcggactcaacctctactgtgggg
A0A2K5CFH3_MCL1-01      -------------------------atcggactcaacctctactgtgggg
A0A2K5CFH3_MCL1-02      -------------------------atcggactcaacctctactgtgggg

A0A2K5D2I1_BCL2A1-      atc-------------------------------------tgcggtacgt
A0A2K5D2I1_BCL2A1-      atc-------------------------------------tgcggtacgt
A0A2K5EBP4_BCL2L1-      gatacagctggagtcagtttagtgatgtggaagagaacaggactgaggcc
A0A2K5EBP4_BCL2L1-      ------------------------atgtggaagagaacaggactgaggcc
A0A2K5CWZ4_BCL2L2-      gttatgtc-----------------tgtgga----------gct--ggcc
A0A2K5CWZ4_BCL2L2-      gttatgtc-----------------tgtgga----------gct--ggcc
A0A2K5CWZ4_BCL2L2-      gttatgtc-----------------tgtgga----------gct--ggcc
A0A2K5EB04_BCL2-01      gctacgagtggga------------tgccggagatgtgggcgccgcaccc
A0A2K5F974_BCL2L10      --------------------------------------ggtggcggacta
A0A2K5DMS4_MCL1-01      ------------------------------------gcggtgccatccct
A0A2K5EPY9_MCL1-02      --------------------------------------ag----------
A0A2K5EPY9_MCL1-01      --------------------------------------aatgcctcatgt
A0A2K5C7L5_MCL1-01      gggccggcttggg------------gactggcagtggcggcaccacccct
A0A2K5CFH3_MCL1-03      gggccggcttggg------------ggccggcagcggcggcgccacccct
A0A2K5CFH3_MCL1-01      gggccggcttggg------------ggccggcagcggcggcgccacccct
A0A2K5CFH3_MCL1-02      gggccggcttggg------------ggccggcagcggcggcgccacccct

A0A2K5D2I1_BCL2A1-      cctgcag-------------------------------------------
A0A2K5D2I1_BCL2A1-      cctgcag-------------------------------------------
A0A2K5EBP4_BCL2L1-      ccagaagggactgattc---------------------------------
A0A2K5EBP4_BCL2L1-      ccagaagggactgattc---------------------------------
A0A2K5CWZ4_BCL2L2-      ccggggagggccca------------------------------------
A0A2K5CWZ4_BCL2L2-      ccggggagggccca------------------------------------
A0A2K5CWZ4_BCL2L2-      ccggggagggccca------------------------------------
A0A2K5EB04_BCL2-01      ccagggg--ccgccccc---------------------------------
A0A2K5F974_BCL2L10      cctggagtactgctccc---------------------------------
A0A2K5DMS4_MCL1-01      ccaggaccgcggctttt---------------------------------
A0A2K5EPY9_MCL1-02      -ccagag-------------------------------------------
A0A2K5EPY9_MCL1-01      tccagac-------------------------------------------
A0A2K5C7L5_MCL1-01      ccgggagggcggcttttggccacggagaaggaggcctcggcccagcgaga
A0A2K5CFH3_MCL1-03      ccgggagggcggcttttggccacggagaaggaggcctcggcccagcgaga
A0A2K5CFH3_MCL1-01      ccgggagggcggcttttggccacggagaaggaggcctcggcccagcgaga
A0A2K5CFH3_MCL1-02      ccgggagggcggctttt---------------------------------

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------gcgccgggcatc
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ggtagggggaggggaggccggcgtggtgattggcggaagcgccggcgcta
A0A2K5CFH3_MCL1-03      ggtagggggaggggaggccggcgcggtgattggcggaagcgccggcgcta
A0A2K5CFH3_MCL1-01      ggtagggggaggggaggccggcgcggtgattggcggaagcgccggcgcta
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      ttctcctcccagcc------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gcccctcggccgccctcacgcctgacgcccgg-gggtcgtgcggccgctg
A0A2K5CFH3_MCL1-03      gccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
A0A2K5CFH3_MCL1-01      gccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      ------------------------------------------------tg
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      c-----------------------------------------------tg
A0A2K5CFH3_MCL1-03      cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgct
A0A2K5CFH3_MCL1-01      cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgct
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      gacacacgcccggtcccgccgcgccccgggacccggtctccaggacctcg
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gttcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccc
A0A2K5CFH3_MCL1-03      gttcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccc
A0A2K5CFH3_MCL1-01      gttcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccc
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      ccgccgccgcccccggc---------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      cggccgccgacgccatcatgtcgcccgaagaagagctggacaggtacgag
A0A2K5CFH3_MCL1-03      cggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgag
A0A2K5CFH3_MCL1-01      cggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgag
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ccggagcctctcgggaagcggccggctgtcctgcccctgctggagttggt
A0A2K5CFH3_MCL1-03      ccggagcctctcgggaagcggccggctgtcctgcccctgctggagttggt
A0A2K5CFH3_MCL1-01      ccggagcctctcgggaagcggccggctgtcctgcccctgctggagttggt
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ggaggagcctggtaatgactccagtacggatgggtcactaccctcgacgc
A0A2K5CFH3_MCL1-03      cggggagcctggtaatggctccagtacggacgggtcactaccctcgacgc
A0A2K5CFH3_MCL1-01      cggggagcctggtaatggctccagtacggacgggtcactaccctcgacgc
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      cgccgaca---------------------------------tcactggag
A0A2K5CFH3_MCL1-03      cgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggag
A0A2K5CFH3_MCL1-01      cgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggag
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      ----------------------------------atacca----------
A0A2K5D2I1_BCL2A1-      ----------------------------------atacca----------
A0A2K5EBP4_BCL2L1-      -----------------ggagatggagacccccagtgccatcaatggcaa
A0A2K5EBP4_BCL2L1-      -----------------ggagatggagacccccagtgccatcaat-----
A0A2K5CWZ4_BCL2L2-      -----------------gcagct---gacccgctgcacca----------
A0A2K5CWZ4_BCL2L2-      -----------------gcagct---gacccgctgcacca----------
A0A2K5CWZ4_BCL2L2-      -----------------gcagct---gacccgctgcacca----------
A0A2K5EB04_BCL2-01      --------------------------cgcccccgccgccg----------
A0A2K5F974_BCL2L10      -------------------------aggagcctggcaccc----------
A0A2K5DMS4_MCL1-01      --------------------------ggcgactggcgcca----------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      attatctctcggtaccttcgggaacaggcgactggcgcca----------
A0A2K5CFH3_MCL1-03      attatctctcggtaccttcgggagcaggcgaccggcgcca----------
A0A2K5CFH3_MCL1-01      attatctctcggtaccttcgggagcaggcgaccggcgcca----------
A0A2K5CFH3_MCL1-02      --------------------------ggcgaccggcgcca----------

A0A2K5D2I1_BCL2A1-      ----------------------------------------------caat
A0A2K5D2I1_BCL2A1-      ----------------------------------------------caat
A0A2K5EBP4_BCL2L1-      cccatcctggcacctggcggacagccccgcggtgaatggagccacgggcc
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      ctggaacgggtccaagcaaaacgtccagggtgctacaaaaggttgcattc
A0A2K5D2I1_BCL2A1-      ctggaacgggtccaagcaaaacgtccagggtgctacaaaaggttgcattc
A0A2K5EBP4_BCL2L1-      acagcagcagtttggatgcccgggaggtgatccccatggcagcagtaaag
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      ccgccacggggcctgcgctca-gcccggtgccacc-----tgtggtccac
A0A2K5F974_BCL2L10      ccgagtc---gccgccgtccacggccgaggccgct---------gtgctg
A0A2K5DMS4_MCL1-01      aggacacaaagccaatgggcaggtctgaggccgccaacagtaaggcgctg
A0A2K5EPY9_MCL1-02      -----------------------------------------------tta
A0A2K5EPY9_MCL1-01      -----------------------------------------------ctg
A0A2K5C7L5_MCL1-01      aggacacaaagccaatggacaggtccggggccgccagcaggaaggctctg
A0A2K5CFH3_MCL1-03      aggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctg
A0A2K5CFH3_MCL1-01      aggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctg
A0A2K5CFH3_MCL1-02      aggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctg

A0A2K5D2I1_BCL2A1-      tcagtccaaaaagaagtggaaaagagtctgaagccatgct----------
A0A2K5D2I1_BCL2A1-      tcagtccaaaaagaagtggaaaagagtctgaagccatgct----------
A0A2K5EBP4_BCL2L1-      caagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggc
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --agcaatgcgggcagctggagatgagttcgagacccgcttccggcgcac
A0A2K5CWZ4_BCL2L2-      --agcaatgcgggcagctggagatgagttcgagacccgcttccggcgcac
A0A2K5CWZ4_BCL2L2-      --agcaatgcgggcagctggagatgagttcgagacccgcttccggcgcac
A0A2K5EB04_BCL2-01      ctgaccctccgccaggccggggacgacttctcccgccgctaccgccgcga
A0A2K5F974_BCL2L10      cgcgcc---------atggccgccggtgtacggaaactctaccggtcctt
A0A2K5DMS4_MCL1-01      gagaccttacgaggggttggggaaggcgtgccccgcaaccacgagatggc
A0A2K5EPY9_MCL1-02      ta---ataac------ttaaagataac------cacatgcatg-------
A0A2K5EPY9_MCL1-01      catgcttttc------tt--------c------cccaggcatg-------
A0A2K5C7L5_MCL1-01      gagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggc
A0A2K5CFH3_MCL1-03      gagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggc
A0A2K5CFH3_MCL1-01      gagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggc
A0A2K5CFH3_MCL1-02      gagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggc

A0A2K5D2I1_BCL2A1-      --------------tggacaatgttaatattgtgtccatagataatgcca
A0A2K5D2I1_BCL2A1-      --------------tggacaatgttaatattgtgtccatagataatgcca
A0A2K5EBP4_BCL2L1-      atttagtgacctgacatcccagctccacatcacccccgggacagcgtatc
A0A2K5EBP4_BCL2L1-      ---------------------gctccacatcacccccgggacagcgtatc
A0A2K5CWZ4_BCL2L2-      cttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaac
A0A2K5CWZ4_BCL2L2-      cttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaac
A0A2K5CWZ4_BCL2L2-      cttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaac
A0A2K5EB04_BCL2-01      cttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggg
A0A2K5F974_BCL2L10      cttctccgcctacctcggctacccgggga------------accgcgtcg
A0A2K5DMS4_MCL1-01      cttacaaggcatgcttcggaatctggacaacaaaaacgaagacaatgtca
A0A2K5EPY9_MCL1-02      cttcgaa-------------aactggacatcaaaaacaaagacgatgtca
A0A2K5EPY9_MCL1-01      cttcgaa-------------aactggacatcaaaaacaaagacgatgtca
A0A2K5C7L5_MCL1-01      cttccaa-------------------------------------------
A0A2K5CFH3_MCL1-03      cttccaa-------------------------------------------
A0A2K5CFH3_MCL1-01      cttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtca
A0A2K5CFH3_MCL1-02      cttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtca

A0A2K5D2I1_BCL2A1-      gaatgatattcagtcaagtgatggaaaaggaatttgaagatgg---catt
A0A2K5D2I1_BCL2A1-      gaatgatattcagtcaagtgatggaaaaggaatttgaagatgg---catt
A0A2K5EBP4_BCL2L1-      agagc---tttgaacaggtagtgaacgaactcttccgggatgg------g
A0A2K5EBP4_BCL2L1-      agagc---tttgaacaggtagtgaacgaactcttccgggatgg------g
A0A2K5CWZ4_BCL2L2-      aacgc---ttcacccaggtctccgatgaacttttccaaggggg------c
A0A2K5CWZ4_BCL2L2-      aacgc---ttcacccaggtctccgatgaacttttccaaggggg------c
A0A2K5CWZ4_BCL2L2-      aacgc---ttcacccaggtctccgatgaacttttccaaggggg------c
A0A2K5EB04_BCL2-01      gacgc---tttgccacggtggtggaggagctcttcagggacgg------g
A0A2K5F974_BCL2L10      agctg---gtggcgaggatggcggaggccctgctctccgacagtcccggc
A0A2K5DMS4_MCL1-01      aatct---tt---------------------------ctacgg---cgta
A0A2K5EPY9_MCL1-02      aatct---ttgtctcgagtgatggtccatgttttcagcgacgg---cgta
A0A2K5EPY9_MCL1-01      aatct---ttgtctcgagtgatggtccatgttttcagcgacgg---cgta
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-01      aatct---ttgtctcgagtgatggtccatgttttcagcgacgg---cgta
A0A2K5CFH3_MCL1-02      aatct---ttgtctcgagtgatggtccatgttttcagcgacgg---cgta

A0A2K5D2I1_BCL2A1-      attaactggggaagaattgtaaccatatttgcatttgaaggtattctcat
A0A2K5D2I1_BCL2A1-      attaactggggaagaattgtaaccatatttgcatttgaaggtattctcat
A0A2K5EBP4_BCL2L1-      gtaaactggggtcgcattgtggcctttttctccttc--------------
A0A2K5EBP4_BCL2L1-      gtaaactggggtcgcattgtggcctttttctccttc--------------
A0A2K5CWZ4_BCL2L2-      cctaactggggccgccttgtagccttctttgtcttt--------------
A0A2K5CWZ4_BCL2L2-      cctaactggggccgccttgtagccttctttgtcttt--------------
A0A2K5CWZ4_BCL2L2-      cctaactggggccgccttgtagccttctttgtcttt--------------
A0A2K5EB04_BCL2-01      gtgaactgggggaggattgtggccttctttgagttc--------------
A0A2K5F974_BCL2L10      cccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgct
A0A2K5DMS4_MCL1-01      acaaactggggtaggattgtgactctcagttctttt--------------
A0A2K5EPY9_MCL1-02      acaaactggggtaggatcgtgactctcatttctttt--------------
A0A2K5EPY9_MCL1-01      acaaactggggtaggatcgtgactctcatttctttt--------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-01      acaaactggggtaggattgtgactctcatttctttt--------------
A0A2K5CFH3_MCL1-02      acaaactggggtaggattgtgactctcatttctttt--------------

A0A2K5D2I1_BCL2A1-      caa----gaaacttctacgagagcgaattgccccggatgtggata-----
A0A2K5D2I1_BCL2A1-      caa----gaaacttctacgagagcgaattgccccggatgtggata-----
A0A2K5EBP4_BCL2L1-      -------gg------cggg----------gcactgtgcgtggaaa-----
A0A2K5EBP4_BCL2L1-      -------gg------cggg----------gcactgtgcgtggaaa-----
A0A2K5CWZ4_BCL2L2-      -------gg------ggct----------gcactgtgtgctgaga-----
A0A2K5CWZ4_BCL2L2-      -------gg------ggct----------gcactgtgtgctgaga-----
A0A2K5CWZ4_BCL2L2-      -------gg------ggct----------gcactgtgtgctgaga-----
A0A2K5EB04_BCL2-01      -------gg------tggg----------gtcatgtgtgtggaga-----
A0A2K5F974_BCL2L10      agagagggggccgctggtg----------accgcccggtggaagaagtgg
A0A2K5DMS4_MCL1-01      -------ggtgcctttgtg----------gccaaacacttgaaga-----
A0A2K5EPY9_MCL1-02      -------ggtgcctttgtg----------gccaaacacttgaaga-----
A0A2K5EPY9_MCL1-01      -------ggtgcctttgtg----------gccaaacacttgaaga-----
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-01      -------ggtgcctttgtg----------gccaaacacttgaaga-----
A0A2K5CFH3_MCL1-02      -------ggtgcctttgtg----------gccaaacacttgaaga-----

A0A2K5D2I1_BCL2A1-      -------------------cttacaaggaga-------------------
A0A2K5D2I1_BCL2A1-      -------------------cttacaaggaga-------------------
A0A2K5EBP4_BCL2L1-      ----------------gcgtagacaaggaga----tgcaggtattggtga
A0A2K5EBP4_BCL2L1-      ----------------gcgtagacaaggaga----tgcaggtattggtga
A0A2K5CWZ4_BCL2L2-      ----------------gtgtcaacaaggaga----tggaaccactggtgg
A0A2K5CWZ4_BCL2L2-      ----------------gtgtcaacaaggaga----tggaaccactggtgg
A0A2K5CWZ4_BCL2L2-      ----------------gtgtcaacaaggaga----tggaaccactggtgg
A0A2K5EB04_BCL2-01      ----------------gcgtcaaccgggaga----tgtcgcccctggtgg
A0A2K5F974_BCL2L10      ggcttccagtcgcggctgaaggagccggagggcgacgtcgcccgggactg
A0A2K5DMS4_MCL1-01      ----------------ccataaaccaagaaagttgcatcga--------a
A0A2K5EPY9_MCL1-02      ----------------ccataaaccaagaaagctgcattga--------a
A0A2K5EPY9_MCL1-01      ----------------ccataaaccaagaaagctgcattga--------a
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-01      ----------------ccataaaccaagaaagctgcattga--------a
A0A2K5CFH3_MCL1-02      ----------------ccataaaccaagaaagctgcattga--------a

A0A2K5D2I1_BCL2A1-      ------tttcgtattttgttgctgagttc----ataatgaataacacagg
A0A2K5D2I1_BCL2A1-      ------tttcgtattttgttgctgagttc----ataatgaataacacagg
A0A2K5EBP4_BCL2L1-      gtcggatcgcagcttggatggccacttac----ctgaatgaccacctaga
A0A2K5EBP4_BCL2L1-      gtcggatcgcagcttggatggccacttac----ctgaatgaccacctaga
A0A2K5CWZ4_BCL2L2-      gacaagtgcaggagtggatggtggcctac----ctggagacgcggctggc
A0A2K5CWZ4_BCL2L2-      gacaagtgcaggagtggatggtggcctac----ctggagacgcggctggc
A0A2K5CWZ4_BCL2L2-      gacaagtgcaggagtggatggtggcctac----ctggagacgcggctggc
A0A2K5EB04_BCL2-01      acaacatcgcgctgtggatgaccgagtac----ctgaaccggcacctgca
A0A2K5F974_BCL2L10      ccagcgcctggtggc--cttgctgagctcgcggctcgtggggcagcaccg
A0A2K5DMS4_MCL1-01      ccattagcagaaagt--at--cagatatt----ctc--------------
A0A2K5EPY9_MCL1-02      ccattagcagaaagt--attacagacgtt----ctcgtaaggacaaaacg
A0A2K5EPY9_MCL1-01      ccattagcagaaagt--attacagacgtt----ctcgtaaggacaaaacg
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-01      ccattagcagaaagt--atcacagacgtt----ctcgtaaggacaaaacg
A0A2K5CFH3_MCL1-02      ccattagcagaaagt--atcacagacgtt----ctcgtaaggacaaaacg

A0A2K5D2I1_BCL2A1-      agaatggataagtcaaaacggaggctggg---------------------
A0A2K5D2I1_BCL2A1-      agaatggataagtcaaaacggaggctggg---------------------
A0A2K5EBP4_BCL2L1-      gccttggatccaggagaacggcggctgggac------acttttgtggaac
A0A2K5EBP4_BCL2L1-      gccttggatccaggagaacggcggctgggac------acttttgtggaac
A0A2K5CWZ4_BCL2L2-      cgactggatccacagcagtgggggctgggagctggaagctatcaaagctc
A0A2K5CWZ4_BCL2L2-      cgactggatccacagcagtgggggctgggcg------gagttcacagctc
A0A2K5CWZ4_BCL2L2-      cgactggatccacagcagtgggggctgggcg------gagttcacagctc
A0A2K5EB04_BCL2-01      cacctggatccaggataacggaggctgggat------gcctttgtgga--
A0A2K5F974_BCL2L10      tgcctggctggaggctcagggcggctggg-t------gagcatgcggagg
A0A2K5DMS4_MCL1-01      -----------------------gctgggat------gggtttgtgga--
A0A2K5EPY9_MCL1-02      ggactggctagttaaacaaagaggctgggat------gggtttgtgga--
A0A2K5EPY9_MCL1-01      ggactggctagttaaacaaagaggctgggat------gggtttgtgga--
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      ---------------------------ggat------gggtttgtgga--
A0A2K5CFH3_MCL1-01      ggactggctagttaaacaaagaggctgggat------gggtttgtgga--
A0A2K5CFH3_MCL1-02      ggactggctagttaaacaaagaggctgggat------gggtttgtgga--

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      tctatggaa---------------------------------------ac
A0A2K5EBP4_BCL2L1-      tctatggaa---------------------------------------ac
A0A2K5CWZ4_BCL2L2-      gagtcagggagatggaggaagaagctgagaagctaaaagaactacagaac
A0A2K5CWZ4_BCL2L2-      tatacgggg---------------------------------------ac
A0A2K5CWZ4_BCL2L2-      tatacgggg---------------------------------------ac
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      gggacacgggcct-----------------------------------cc
A0A2K5DMS4_MCL1-01      --------gttct-----------------------------------tc
A0A2K5EPY9_MCL1-02      --------gttct-----------------------------------tc
A0A2K5EPY9_MCL1-01      --------gttct-----------------------------------tc
A0A2K5C7L5_MCL1-01      --------gttct-----------------------------------tc
A0A2K5CFH3_MCL1-03      --------gttct-----------------------------------tc
A0A2K5CFH3_MCL1-01      --------gttct-----------------------------------tc
A0A2K5CFH3_MCL1-02      --------gttct-----------------------------------tc

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      aatg----------------------------------------------
A0A2K5EBP4_BCL2L1-      aatg----------------------------------------------
A0A2K5CWZ4_BCL2L2-      gaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccc
A0A2K5CWZ4_BCL2L2-      gggg----------------------------------------------
A0A2K5CWZ4_BCL2L2-      gggg----------------------------------------------
A0A2K5EB04_BCL2-01      actg----------------------------------------------
A0A2K5F974_BCL2L10      cgag----------------------------------------------
A0A2K5DMS4_MCL1-01      cgtg----------------------------------------------
A0A2K5EPY9_MCL1-02      catg----------------------------------------------
A0A2K5EPY9_MCL1-01      catg----------------------------------------------
A0A2K5C7L5_MCL1-01      catg----------------------------------------------
A0A2K5CFH3_MCL1-03      catg----------------------------------------------
A0A2K5CFH3_MCL1-01      catg----------------------------------------------
A0A2K5CFH3_MCL1-02      catg----------------------------------------------

A0A2K5D2I1_BCL2A1-      --------------------------cgaaatg-----------------
A0A2K5D2I1_BCL2A1-      ---------------------------aaaatg-----------------
A0A2K5EBP4_BCL2L1-      --------------------------cggcagc-----------------
A0A2K5EBP4_BCL2L1-      --------------------------cggcagc-----------------
A0A2K5CWZ4_BCL2L2-      agtgatcatgtccattgaggagaagatggaggc-----------------
A0A2K5CWZ4_BCL2L2-      -----------ccctggaggaggcg-cggcgtc-----------------
A0A2K5CWZ4_BCL2L2-      -----------ccctggaggaggcg-cggcgtc-----------------
A0A2K5EB04_BCL2-01      --------------ta----tggccccagcatg-----------------
A0A2K5F974_BCL2L10      --------------tagctgggaatataggatggcttttgttacttcttc
A0A2K5DMS4_MCL1-01      --------------ta---gaggacttagaagg-----------------
A0A2K5EPY9_MCL1-02      --------------ta---gaggacctagaagg-----------------
A0A2K5EPY9_MCL1-01      --------------ta---gaggacctagaagg-----------------
A0A2K5C7L5_MCL1-01      --------------ta---gaagacctagaagg-----------------
A0A2K5CFH3_MCL1-03      --------------ta---gaggacctagaagg-----------------
A0A2K5CFH3_MCL1-01      --------------ta---gaggacctagaagg-----------------
A0A2K5CFH3_MCL1-02      --------------ta---gaggacctagaagg-----------------

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ----------------cg--------------------------------
A0A2K5EBP4_BCL2L1-      ----------------cg--------------------------------
A0A2K5CWZ4_BCL2L2-      ----------------tgatgcccgttccatctatgttggcaatgtggac
A0A2K5CWZ4_BCL2L2-      ----------------tg--------------------------------
A0A2K5CWZ4_BCL2L2-      ----------------tg--------------------------------
A0A2K5EB04_BCL2-01      ----------------cg--------------------------------
A0A2K5F974_BCL2L10      aggacctcctcctcgctg--------------------------------
A0A2K5DMS4_MCL1-01      ----------------tg--------------------------------
A0A2K5EPY9_MCL1-02      ----------------tg--------------------------------
A0A2K5EPY9_MCL1-01      ----------------tg--------------------------------
A0A2K5C7L5_MCL1-01      ----------------tg--------------------------------
A0A2K5CFH3_MCL1-03      ----------------tg--------------------------------
A0A2K5CFH3_MCL1-01      ----------------tg--------------------------------
A0A2K5CFH3_MCL1-02      ----------------tg--------------------------------

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      -----------------agagccga-------------------------
A0A2K5EBP4_BCL2L1-      -----------------agagccga-------------------------
A0A2K5CWZ4_BCL2L2-      tatggtgcaacagcagaagagctggaagctcactttcatggctgtggttc
A0A2K5CWZ4_BCL2L2-      ----------cgggaggggaactgg-------------------------
A0A2K5CWZ4_BCL2L2-      ----------cgggaggggaactgg-------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      agtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaag
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      -----------------------------gc--------acag-------
A0A2K5D2I1_BCL2A1-      -----------------------------gctttgtaaagaag-------
A0A2K5EBP4_BCL2L1-      ---------------------------aagggccag-gagcgcttcaacc
A0A2K5EBP4_BCL2L1-      ---------------------------aagggccag-gagcgcttcaacc
A0A2K5CWZ4_BCL2L2-      ggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttg
A0A2K5CWZ4_BCL2L2-      -----------------------------gcatcagtgaggac-------
A0A2K5CWZ4_BCL2L2-      -----------------------------gcatcagtgaggac-------
A0A2K5EB04_BCL2-01      -----------------------------gcctctgtttgatt-------
A0A2K5F974_BCL2L10      -----------------------------gcattatggagaaa-------
A0A2K5DMS4_MCL1-01      -----------------------------gcatca-gaaatgg-------
A0A2K5EPY9_MCL1-02      -----------------------------gcatca-gaaatgt-------
A0A2K5EPY9_MCL1-01      -----------------------------gcatca-gaaatgt-------
A0A2K5C7L5_MCL1-01      -----------------------------gcatca-gaaatgt-------
A0A2K5CFH3_MCL1-03      -----------------------------gcatca-gaaatgt-------
A0A2K5CFH3_MCL1-01      -----------------------------gcatca-gaaatgt-------
A0A2K5CFH3_MCL1-02      -----------------------------gcatca-gaaatgt-------

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      gccttagatgagtccctatttagaggaaggcaaatcaaggttgactttaa
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPY9_MCL1-02      --------------------------------------------------
A0A2K5EPY9_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-02      --------------------------------------------------

A0A2K5D2I1_BCL2A1-      ---------------------------tctcctgcttgtg----------
A0A2K5D2I1_BCL2A1-      ---------------------------tttgaacctaaat----------
A0A2K5EBP4_BCL2L1-      ---------------------------gctggttc---------------
A0A2K5EBP4_BCL2L1-      ---------------------------gctggttc---------------
A0A2K5CWZ4_BCL2L2-      ggctttcatttattcatctctgactcaggtgatcccgaaacgaaccaaca
A0A2K5CWZ4_BCL2L2-      ---------------------------agtg-------------------
A0A2K5CWZ4_BCL2L2-      ---------------------------agtg-------------------
A0A2K5EB04_BCL2-01      ---------------------------tctc-------------------
A0A2K5F974_BCL2L10      ---------------------------actg-------------------
A0A2K5DMS4_MCL1-01      ---------------------------gctg-------------------
A0A2K5EPY9_MCL1-02      ---------------------------gctg-------------------
A0A2K5EPY9_MCL1-01      ---------------------------gctg-------------------
A0A2K5C7L5_MCL1-01      ---------------------------gctg-------------------
A0A2K5CFH3_MCL1-03      ---------------------------gctg-------------------
A0A2K5CFH3_MCL1-01      ---------------------------gctg-------------------
A0A2K5CFH3_MCL1-02      ---------------------------gctg-------------------

A0A2K5D2I1_BCL2A1-      ------------------ctggtggagt----------------------
A0A2K5D2I1_BCL2A1-      ------------------ctggctggat----------------------
A0A2K5EBP4_BCL2L1-      ------------------ctgacgggca----------------------
A0A2K5EBP4_BCL2L1-      ------------------ctgacgggca----------------------
A0A2K5CWZ4_BCL2L2-      gaccaggcatcagcacaacagaccggggttttccacgagcccgctaccgc
A0A2K5CWZ4_BCL2L2-      ------------------ctgacagggg----------------------
A0A2K5CWZ4_BCL2L2-      ------------------ctgacagggg----------------------
A0A2K5EB04_BCL2-01      ------------------ctggctgtct----------------------
A0A2K5F974_BCL2L10      ------------------ctggtc--------------------------
A0A2K5DMS4_MCL1-01      ------------------ctggctttcg----------------------
A0A2K5EPY9_MCL1-02      ------------------ctggcttttg----------------------
A0A2K5EPY9_MCL1-01      ------------------ctggcttttg----------------------
A0A2K5C7L5_MCL1-01      ------------------ctggcttttg----------------------
A0A2K5CFH3_MCL1-03      ------------------ctggcttttg----------------------
A0A2K5CFH3_MCL1-01      ------------------ctggcttttg----------------------
A0A2K5CFH3_MCL1-02      ------------------ctggcttttg----------------------
                                          * *                             

A0A2K5D2I1_BCL2A1-      -----------------------------------------cag------
A0A2K5D2I1_BCL2A1-      -----------------------------------------gac------
A0A2K5EBP4_BCL2L1-      --------------------------------------tgactg------
A0A2K5EBP4_BCL2L1-      --------------------------------------tgactg------
A0A2K5CWZ4_BCL2L2-      gcacggaccaccaactacaacagttcccgctctcgattctacag------
A0A2K5CWZ4_BCL2L2-      -----------------------------------------ccg------
A0A2K5CWZ4_BCL2L2-      -----------------------------------------ccg------
A0A2K5EB04_BCL2-01      -----------------------------------------ctgaagact
A0A2K5F974_BCL2L10      -----------------------------------------cag------
A0A2K5DMS4_MCL1-01      -----------------------------------------cag------
A0A2K5EPY9_MCL1-02      -----------------------------------------cat------
A0A2K5EPY9_MCL1-01      -----------------------------------------cat------
A0A2K5C7L5_MCL1-01      -----------------------------------------cag------
A0A2K5CFH3_MCL1-03      -----------------------------------------cag------
A0A2K5CFH3_MCL1-01      -----------------------------------------cag------
A0A2K5CFH3_MCL1-02      -----------------------------------------cag------

A0A2K5D2I1_BCL2A1-      -----------------------------tggcccagaaggagaggaa--
A0A2K5D2I1_BCL2A1-      -----------------------------ttttctagaagttacagga--
A0A2K5EBP4_BCL2L1-      ----------tggc---------------cggcgtggt-tctgctgggct
A0A2K5EBP4_BCL2L1-      ----------tggc---------------cggcgtggt-tctgctgggct
A0A2K5CWZ4_BCL2L2-      ----------tggttttaacagcaggccccggggtcgcgtctacaggggc
A0A2K5CWZ4_BCL2L2-      ----------tggc----actgggggccctg-----gtaactgtaggggc
A0A2K5CWZ4_BCL2L2-      ----------tggc----actgggggccctg-----gtaactgtaggggc
A0A2K5EB04_BCL2-01      ctgctcagcttggc---------------cctggtgggagcttgcatcac
A0A2K5F974_BCL2L10      -------gttttcc---------------tgtcatggttgttaa--cagc
A0A2K5DMS4_MCL1-01      -------gtgttgc---------------tggagtaggaactgatttggc
A0A2K5EPY9_MCL1-02      -------gtgttgc---------------tggagtaggagctggtttggc
A0A2K5EPY9_MCL1-01      -------gtgttgc---------------tggagtaggagctggtttggc
A0A2K5C7L5_MCL1-01      -------gtgttgc---------------tggagtaggagctggtttggc
A0A2K5CFH3_MCL1-03      -------gtgttgc---------------tggagtaggagctggtttggc
A0A2K5CFH3_MCL1-01      -------gtgttgc---------------tggagtaggagctggtttggc
A0A2K5CFH3_MCL1-02      -------gtgttgc---------------tggagtaggagctggtttggc

A0A2K5D2I1_BCL2A1-      --------------------aatggctttgtaa-----------------
A0A2K5D2I1_BCL2A1-      --------------------aagatctgcgaaatgctatctctcttgaag
A0A2K5EBP4_BCL2L1-      c-------------------actctttagtc--------ggaaatga---
A0A2K5EBP4_BCL2L1-      c-------------------actctttagtc--------ggaaatga---
A0A2K5CWZ4_BCL2L2-      cgggctagagcgacatcatggtattcccctt--------ac---taa---
A0A2K5CWZ4_BCL2L2-      c--------------------ttttttgcta--------gcaagtga---
A0A2K5CWZ4_BCL2L2-      c--------------------ttttttgcta--------gcaagtga---
A0A2K5EB04_BCL2-01      c----------------ctgggtgcctatctgggcc---acaagtga---
A0A2K5F974_BCL2L10      --------------------agcattcatctacttctggacacgataatt
A0A2K5DMS4_MCL1-01      --------------------a-tatcta-----------ataagatag--
A0A2K5EPY9_MCL1-02      --------------------a-tatcta-----------ataagatag--
A0A2K5EPY9_MCL1-01      --------------------a-tatcta-----------ataagatag--
A0A2K5C7L5_MCL1-01      --------------------a-tatcta-----------ataagatagcc
A0A2K5CFH3_MCL1-03      --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------actgtctc-----------tt---atacac
A0A2K5CFH3_MCL1-02      --------------------actgtctc-----------tt---atacac

A0A2K5D2I1_BCL2A1-      ------------
A0A2K5D2I1_BCL2A1-      caatactattga
A0A2K5EBP4_BCL2L1-      ------------
A0A2K5EBP4_BCL2L1-      ------------
A0A2K5CWZ4_BCL2L2-      ------------
A0A2K5CWZ4_BCL2L2-      ------------
A0A2K5CWZ4_BCL2L2-      ------------
A0A2K5EB04_BCL2-01      ------------
A0A2K5F974_BCL2L10      aggagtttttaa
A0A2K5DMS4_MCL1-01      ------------
A0A2K5EPY9_MCL1-02      ------------
A0A2K5EPY9_MCL1-01      ------------
A0A2K5C7L5_MCL1-01      t------tgtaa
A0A2K5CFH3_MCL1-03      ------------
A0A2K5CFH3_MCL1-01      a------tctag
A0A2K5CFH3_MCL1-02      a------tctag

© 1998-2019