Dataset for CDS BCL2L2 of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      atgccccttctggttctctgtccatatattcatgccagtctttcatcctt
A0A2K5CWZ4_BCL2L2-      ------------------------------------catctttcatcctt
                                                                          

A0A2K5CWZ4_BCL2L2-      -------------------atggcgaccccagcctcggccccagacacac
A0A2K5CWZ4_BCL2L2-      gcctcttatagccgcccggatggcgaccccagcctcggccccagacacac
A0A2K5CWZ4_BCL2L2-      gcctcttatagccgcccggatggcgaccccagcctcggccccagacacac
                                           *******************************

A0A2K5CWZ4_BCL2L2-      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
A0A2K5CWZ4_BCL2L2-      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
A0A2K5CWZ4_BCL2L2-      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
                        **************************************************

A0A2K5CWZ4_BCL2L2-      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
A0A2K5CWZ4_BCL2L2-      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
A0A2K5CWZ4_BCL2L2-      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
                        **************************************************

A0A2K5CWZ4_BCL2L2-      agcaatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
A0A2K5CWZ4_BCL2L2-      agcaatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
A0A2K5CWZ4_BCL2L2-      agcaatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
                        **************************************************

A0A2K5CWZ4_BCL2L2-      tctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaa
A0A2K5CWZ4_BCL2L2-      tctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaa
A0A2K5CWZ4_BCL2L2-      tctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaa
                        **************************************************

A0A2K5CWZ4_BCL2L2-      cgcttcacccaggtctccgatgaacttttccaagggggccctaactgggg
A0A2K5CWZ4_BCL2L2-      cgcttcacccaggtctccgatgaacttttccaagggggccctaactgggg
A0A2K5CWZ4_BCL2L2-      cgcttcacccaggtctccgatgaacttttccaagggggccctaactgggg
                        **************************************************

A0A2K5CWZ4_BCL2L2-      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
A0A2K5CWZ4_BCL2L2-      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
A0A2K5CWZ4_BCL2L2-      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
                        **************************************************

A0A2K5CWZ4_BCL2L2-      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
A0A2K5CWZ4_BCL2L2-      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
A0A2K5CWZ4_BCL2L2-      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
                        **************************************************

A0A2K5CWZ4_BCL2L2-      gcctacctggagacgcggctggccgactggatccacagcagtgggggctg
A0A2K5CWZ4_BCL2L2-      gcctacctggagacgcggctggccgactggatccacagcagtgggggctg
A0A2K5CWZ4_BCL2L2-      gcctacctggagacgcggctggccgactggatccacagcagtgggggctg
                        **************************************************

A0A2K5CWZ4_BCL2L2-      ggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctg
A0A2K5CWZ4_BCL2L2-      ggcg------gagttcacagctctatacgggg------------------
A0A2K5CWZ4_BCL2L2-      ggcg------gagttcacagctctatacgggg------------------
                        ** *      *   *** ***** *  * ***                  

A0A2K5CWZ4_BCL2L2-      agaagctaaaagaactacagaacgaggtagagaagcagatgaatatgagt
A0A2K5CWZ4_BCL2L2-      ---------------------acgggg-----------------------
A0A2K5CWZ4_BCL2L2-      ---------------------acgggg-----------------------
                                             *** **                       

A0A2K5CWZ4_BCL2L2-      ccacctccaggcaatgctggcccagtgatcatgtccattgaggagaagat
A0A2K5CWZ4_BCL2L2-      ----------------------------------ccctggaggaggcg-c
A0A2K5CWZ4_BCL2L2-      ----------------------------------ccctggaggaggcg-c
                                                          ** * ******  *  

A0A2K5CWZ4_BCL2L2-      ggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaa
A0A2K5CWZ4_BCL2L2-      ggcgtctg------------------------------------------
A0A2K5CWZ4_BCL2L2-      ggcgtctg------------------------------------------
                        ** * ***                                          

A0A2K5CWZ4_BCL2L2-      cagcagaagagctggaagctcactttcatggctgtggttcagtcaaccgt
A0A2K5CWZ4_BCL2L2-      cgggaggggaactgg-----------------------------------
A0A2K5CWZ4_BCL2L2-      cgggaggggaactgg-----------------------------------
                        * * **  ** ****                                   

A0A2K5CWZ4_BCL2L2-      gttaccatactctgtgacaaatttagtggccatcccaaagggtttgcata
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5CWZ4_BCL2L2-      tatagagttctcagacaaagagtcagtgaggacttccttggccttagatg
A0A2K5CWZ4_BCL2L2-      -------------------gcatcagtgaggac-----------------
A0A2K5CWZ4_BCL2L2-      -------------------gcatcagtgaggac-----------------
                                           *  ***********                 

A0A2K5CWZ4_BCL2L2-      agtccctatttagaggaaggcaaatcaaggttgactttaaggctttcatt
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
A0A2K5CWZ4_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5CWZ4_BCL2L2-      tattcatctctgactcaggtgatcccgaaacgaaccaacagaccaggcat
A0A2K5CWZ4_BCL2L2-      -----------------agtg-----------------------------
A0A2K5CWZ4_BCL2L2-      -----------------agtg-----------------------------
                                          ***                             

A0A2K5CWZ4_BCL2L2-      cagcacaacagaccggggttttccacgagcccgctaccgcgcacggacca
A0A2K5CWZ4_BCL2L2-      --------ctgacagggg--------------------------------
A0A2K5CWZ4_BCL2L2-      --------ctgacagggg--------------------------------
                                * *** ****                                

A0A2K5CWZ4_BCL2L2-      ccaactacaacagttcccgctctcgattctacagtggttttaacagcagg
A0A2K5CWZ4_BCL2L2-      -------------------------------ccgtggc----actggggg
A0A2K5CWZ4_BCL2L2-      -------------------------------ccgtggc----actggggg
                                                       * ****     ** *  **

A0A2K5CWZ4_BCL2L2-      ccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattc
A0A2K5CWZ4_BCL2L2-      ccctg-----gtaactgtaggggcc--------------------ttttt
A0A2K5CWZ4_BCL2L2-      ccctg-----gtaactgtaggggcc--------------------ttttt
                        *** *     *   **  *******                    * ** 

A0A2K5CWZ4_BCL2L2-      cccttac---taa
A0A2K5CWZ4_BCL2L2-      tgctagcaagtga
A0A2K5CWZ4_BCL2L2-      tgctagcaagtga
                          **  *   * *

© 1998-2018