Dataset for CDS BCL2A1 of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5D2I1_BCL2A1-      atgacagactgtgaatttggatatattcacaatctaactcaggactatct
A0A2K5D2I1_BCL2A1-      atgacagactgtgaatttggatatattcacaatctaactcaggactatct

A0A2K5D2I1_BCL2A1-      gcggtacgtcctgcagataccacaatctggaacgggtccaagcaaaacgt
A0A2K5D2I1_BCL2A1-      gcggtacgtcctgcagataccacaatctggaacgggtccaagcaaaacgt

A0A2K5D2I1_BCL2A1-      ccagggtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaag
A0A2K5D2I1_BCL2A1-      ccagggtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaag

A0A2K5D2I1_BCL2A1-      agtctgaagccatgcttggacaatgttaatattgtgtccatagataatgc
A0A2K5D2I1_BCL2A1-      agtctgaagccatgcttggacaatgttaatattgtgtccatagataatgc

A0A2K5D2I1_BCL2A1-      cagaatgatattcagtcaagtgatggaaaaggaatttgaagatggcatta
A0A2K5D2I1_BCL2A1-      cagaatgatattcagtcaagtgatggaaaaggaatttgaagatggcatta

A0A2K5D2I1_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K5D2I1_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc

A0A2K5D2I1_BCL2A1-      aagaaacttctacgagagcgaattgccccggatgtggatacttacaagga
A0A2K5D2I1_BCL2A1-      aagaaacttctacgagagcgaattgccccggatgtggatacttacaagga

A0A2K5D2I1_BCL2A1-      gatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
A0A2K5D2I1_BCL2A1-      gatttcgtattttgttgctgagttcataatgaataacacaggagaatgga

A0A2K5D2I1_BCL2A1-      taagtcaaaacggaggctgggcgaaatggc--------acagtctcctgc
A0A2K5D2I1_BCL2A1-      taagtcaaaacggaggctggg-aaaatggctttgtaaagaagtttgaacc
                        *********************  *******          *** *    *

A0A2K5D2I1_BCL2A1-      ttgtgctggtggagtcagtggcccagaaggagaggaaaatggctttgtaa
A0A2K5D2I1_BCL2A1-      taaatctggctggatgacttttctagaagttacaggaaagatctgcgaaa
                        *    ****  *  * * *   * *****     * ***   **  * **

A0A2K5D2I1_BCL2A1-      -----------------------------
A0A2K5D2I1_BCL2A1-      tgctatctctcttgaagcaatactattga

© 1998-2019