Dataset for CDS MCL-1 of organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


R4GAJ0_MCL1-01      atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaac
R4GAJ0_MCL1-02      ------------------------------------------------atggccccgaac
                                                                    ************

R4GAJ0_MCL1-01      acgccggcctcacctggagccggcggaggcgtcggagaaagtagcggcgggaataataac
R4GAJ0_MCL1-02      acgccggcctcacctggagccggcggaggcgtcggagaaagtagcggcgggaataataac
                    ************************************************************

R4GAJ0_MCL1-01      gacggcggcggcgtctcggttccgaaggcctcaggtcttttctcagagaggccgcgccct
R4GAJ0_MCL1-02      gacggcggcggcgtctcggttccgaaggcctcaggtcttttctcagagaggccgcgccct
                    ************************************************************

R4GAJ0_MCL1-01      ctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
R4GAJ0_MCL1-02      ctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
                    ************************************************************

R4GAJ0_MCL1-01      tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgc
R4GAJ0_MCL1-02      tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgc
                    ************************************************************

R4GAJ0_MCL1-01      ccggcctccctgccgctgcctgaaggggagctcgacggctgcgaggaagccgaggaggag
R4GAJ0_MCL1-02      ccggcctccctgccgctgcctgaaggggagctcgacggctgcgaggaagccgaggaggag
                    ************************************************************

R4GAJ0_MCL1-01      gaggccgcgacggtgccgtcttccaccccctcgccggacaaagagatggcggaggaggaa
R4GAJ0_MCL1-02      gaggccgcgacggtgccgtcttccaccccctcgccggacaaagagatggcggaggaggaa
                    ************************************************************

R4GAJ0_MCL1-01      ggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
R4GAJ0_MCL1-02      ggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
                    ************************************************************

R4GAJ0_MCL1-01      gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccggg
R4GAJ0_MCL1-02      gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccggg
                    ************************************************************

R4GAJ0_MCL1-01      cccaagttctccttccaaggcttgctggggcgcttcgggagcagccccaacgaggcggag
R4GAJ0_MCL1-02      cccaagttctccttccaaggcttgctggggcgcttcgggagcagccccaacgaggcggag
                    ************************************************************

R4GAJ0_MCL1-01      gtggcgcgcgcgctggagacgctgcgccgggtgggcgagagcctccgggagaagcacctg
R4GAJ0_MCL1-02      gtggcgcgcgcgctggagacgctgcgccgggtgggcgagagcctccgggagaagcacctg
                    ************************************************************

R4GAJ0_MCL1-01      ctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
R4GAJ0_MCL1-02      ctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
                    ************************************************************

R4GAJ0_MCL1-01      gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtg
R4GAJ0_MCL1-02      gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtg
                    ************************************************************

R4GAJ0_MCL1-01      actctcatctcttttggtgcctttgttgccaaacacctgaagagcataaaccaagagaat
R4GAJ0_MCL1-02      actctcatctcttttggtgcctttgttgccaaacacctgaagagcataaaccaagagaat
                    ************************************************************

R4GAJ0_MCL1-01      gctatcaacactttaatagaaattatcactgatgtgctggtgacggacaagagagaatgg
R4GAJ0_MCL1-02      gctatcaacactttaatagaaattatcactgatgtgctggtgacggacaagagagaatgg
                    ************************************************************

R4GAJ0_MCL1-01      ctattgaaacataatgcctggca-------------------------------------
R4GAJ0_MCL1-02      ctattgaaacataatgcctgggagggatttgttcagttcttccatgtagaggacatagaa
                    ********************* *                                     

R4GAJ0_MCL1-01      -------------------------------caactgtgtctga----------------
R4GAJ0_MCL1-02      ggtggcatcaggaatgttctggtggcttttgccagtgtggctggaataggggcaggcttg
                                                   * * **** ***                 

R4GAJ0_MCL1-01      ------------------
R4GAJ0_MCL1-02      gcctacatgatccggtga
                                      

© 1998-2019