Dataset for CDS BCL-2-like of organism Anas platyrhynchos

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

U3IRH3_MCL1-01        ------------------------------catttt--------------
U3II49_BCL2-01        --------------------------------------------------
U3IS71_BCL2L1-01      atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagct

U3IRH3_MCL1-01        --------------------------------------------------
U3II49_BCL2-01        --------------------------------------------------
U3IS71_BCL2L1-01      gtcgcagaaaggctacagctggagccagctggaggaagaggatgagaaca

U3IRH3_MCL1-01        gggctggtt-----------------------------------------
U3II49_BCL2-01        ggact---------------------------------------------
U3IS71_BCL2L1-01      ggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcc
                      ** **                                             

U3IRH3_MCL1-01        ---------tcacccaactcagaagcgagctc------------------
U3II49_BCL2-01        ---------ccacctcgcc-------------------------------
U3IS71_BCL2L1-01      tggcaccccccagctggccaggtagtgaacggcgccgccgtgcaccggag
                                ** *   *                                

U3IRH3_MCL1-01        -------------------------------------------------c
U3II49_BCL2-01        -------------------------------------------------c
U3IS71_BCL2L1-01      cagcctggaggtccacgagcttgttcaatcggccgccgtccggcaggctc

U3IRH3_MCL1-01        cgagccagctgcggggggggag----caggggggggtcaccgagtctctg
U3II49_BCL2-01        tgcgccag--gccggggacgagttctcccgtcgctaccagcgggacttc-
U3IS71_BCL2L1-01      tgcgcgaa--gccggggatgaattcgagctgaggtaccgccgggctttc-
                       * ** *   ** ****  **           *    *  ** *  *   

U3IRH3_MCL1-01        agccaacctctcttgcaggaatgcttcggaagctggaaatcaagaaggag
U3II49_BCL2-01        -gcccagatgtccggc-------------cagctgcacctgacaccnnnn
U3IS71_BCL2L1-01      -agcgacctcacctcc-------------cagctccacatcacccccggc
                         * *  *  *   *              ****  *  * *        

U3IRH3_MCL1-01        gaggacctgcagg----ccgtgggtgaggtggcggcccacctcttcagcg
U3II49_BCL2-01        acgg----ccagaggccgcttcgtggccgtggtggaggagctcttccgag
U3IS71_BCL2L1-01      acggcttaccaga----gcttcgagcaggtggtgaacgaacttttccgcg
                        **     ***      * * *     **** *    * ** *** * *

U3IRH3_MCL1-01        acggggtgaccaactgggggcgcgtcgtcaccctcatctccttcggcgcc
U3II49_BCL2-01        acggggtg---aactggggccggatcgtggccttcttcgagttcgg----
U3IS71_BCL2L1-01      atggggtg---aactgggggcgcatcgtggccttcttctccttcgg----
                      * ******   ******** **  ****  ** ** **   *****    

U3IRH3_MCL1-01        ttcgtcgcccggcacctgaaaagcgtaaagcaggaga-------------
U3II49_BCL2-01        --cggcgtcatgtgcgtggagagcgtcaaccgggagatgtctcccctggt
U3IS71_BCL2L1-01      --aggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggt
                         *  *    *  * ** * *****  *   *****             

U3IRH3_MCL1-01        --aaagcatcggctccctggccaggatcatcaccgacctcg-tctcgtcc
U3II49_BCL2-01        ggacagcatcg------ccgcctggatgaccgagtacctga---------
U3IS71_BCL2L1-01      ggggcgcatcg------tggcctggatgaccacctaccggagggcagagc
                           ******        *** **** * *    ***            

U3IRH3_MCL1-01        aaacgcgagtggctcgtgagccagggaggctgggagggtttcgtcgactt
U3II49_BCL2-01        --------------------------------------------------
U3IS71_BCL2L1-01      tggagaaagcattttctgagggaggagggatggagcggtttgtggacctc

U3IRH3_MCL1-01        tttccgagtggaagacctgg-----------------aaggcagcatcag
U3II49_BCL2-01        -accggcac-------ctgc-----------------------------a
U3IS71_BCL2L1-01      tacgggaacgatgctgctgcggagatgaggaagggccaggaaaccttcaa
                           *          ***                               

U3IRH3_MCL1-01        gaacgtgctgatggcgttcgcaggagtggctggactgggagcgagcttgg
U3II49_BCL2-01        caactggat-----ccaggacaacggaggctgg-----------------
U3IS71_BCL2L1-01      caaatggctcctgaccggggccacggtggccggagtgctcctgctgggat
                       **   * *     *     *    * *** **                 

U3IRH3_MCL1-01        cctacatgatccggtga
U3II49_BCL2-01        -----------------
U3IS71_BCL2L1-01      ccctgctgagcccaagt

© 1998-2019