Dataset for CDS BCL-2-like of organism Anas platyrhynchos platyrhynchos

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A493SSZ7_BCL2A1-      --atgga-------------------------aact----gctga-----
A0A493U0E8_MCL1-01      ggagggt------gggggacggagtcctggagaaacacgagctggccttc
A0A493T1X3_BCL2-01      --atggctcatcccgggagaagaggctacgataaccgggagatag-----
A0A493TIA6_BCL2L1-      --atgtc------------------cagcggcaaccgggagctgg-----
                          * *                           **      * *       

A0A493SSZ7_BCL2A1-      ---------gttctattacgtttatt------------------------
A0A493U0E8_MCL1-01      caagggaccggcgagatctgaccatttggggtcagttttgtggaaatcgg
A0A493T1X3_BCL2-01      --------tgctgaagtacatccact------------------------
A0A493TIA6_BCL2L1-      --------tgatcgactttgtctcct------------------------
                                 *      *        *                        

A0A493SSZ7_BCL2A1-      -atttagctcaagattatctgcaatatgt---------------------
A0A493U0E8_MCL1-01      aggcgagctctcagggaccagcaagaattgaccattttgggtcagttcca
A0A493T1X3_BCL2-01      --ataaactctcgcagaggggatacgact---------------------
A0A493TIA6_BCL2L1-      --acaagctgtcgcagaaaggctacagct---------------------
                             * **       *   *  *    *                     

A0A493SSZ7_BCL2A1-      ----------------gcttcaggaa------------------------
A0A493U0E8_MCL1-01      tggaattcagaggcgagtccccggggagtggtgggaactgcccattttgg
A0A493T1X3_BCL2-01      ---------gg-----gctgccgg-------cgaggacag----------
A0A493TIA6_BCL2L1-      ---------ggagccagctggaggaagaggatgagaacag----------
                                        *     **                          

A0A493SSZ7_BCL2A1-      ------------------------tcacatcttggaccagcgcaa-----
A0A493U0E8_MCL1-01      gtcagttttgtggaactcggaagcgagcccctggggatggggcggaaccg
A0A493T1X3_BCL2-01      ----ggcgcccgcgcctacggctctcgctcctgctgctgctgcgg-----
A0A493TIA6_BCL2L1-      ----g------------actgagttggcttccgaggccgccgcgg-----
                                                   *  *          **       

A0A493SSZ7_BCL2A1-      ---------------------------------accagagttgctcatgt
A0A493U0E8_MCL1-01      accattttggggctgttttcccagaacccagcagcgggattttttccaga
A0A493T1X3_BCL2-01      ------ttg------------------ctgctgctgggactccctcccgc
A0A493TIA6_BCL2L1-      -------tg------------------ct--caacgggagcccctcctgg
                                                             **     **  * 

A0A493SSZ7_BCL2A1-      c-------------------------------------------------
A0A493U0E8_MCL1-01      ccagcacgtaccaaccctttgggatcagctccacggggacgggggggaga
A0A493T1X3_BCL2-01      c--------accgccccgccgggctgctgtccccgcaccccgag------
A0A493TIA6_BCL2L1-      c--------accccccagccggccaggta-----gtgaacggcg------
                        *                                                 

A0A493SSZ7_BCL2A1-      ---------------------ttgcgaaacattgcatc-----------t
A0A493U0E8_MCL1-01      tttgaccattttgggctggtttcacccaactcagaagcgagctcccgagc
A0A493T1X3_BCL2-01      ---------------------ccccccggctcggctgc---------tgc
A0A493TIA6_BCL2L1-      ---------------------ccgccgtgcaccggagc---------agc
                                                *    *   *   *            

A0A493SSZ7_BCL2A1-      tcgctgcaaga--------------tcaaacagaggaggctctcag----
A0A493U0E8_MCL1-01      cagctgggcggcgagacgccgcccctcccgcagcaggatgttgcactttt
A0A493T1X3_BCL2-01      tagcgaggcg---------------cccccgggcgaggggctgcgc----
A0A493TIA6_BCL2L1-      ---ctggagg---------------tccacgagctcg----ttcaa----
                           *     *                *     *          *      

A0A493SSZ7_BCL2A1-      ----------------------------------------------accc
A0A493U0E8_MCL1-01      aaaaaatgcaaaaggtttcgagccggcccccaccccttccctcatcaccc
A0A493T1X3_BCL2-01      ----------------------cccgcgccccccgtggtccacctcgccc
A0A493TIA6_BCL2L1-      ----------------------tcag------ccgccgtccggcaggctc
                                                                       * *

A0A493SSZ7_BCL2A1-      ttcctggacagg------------------attgatatcagttctgtaga
A0A493U0E8_MCL1-01      tgctgggcgagatttttggggtttcaccacccccggccaaatttttgggg
A0A493T1X3_BCL2-01      tgc---gccagg------------------ccggggacgagttctcccgt
A0A493TIA6_BCL2L1-      tgc---gcgaag------------------ccggggacgaattcgagctg
                        * *   *  *                             * **       

A0A493SSZ7_BCL2A1-      tgtt-------------------------------------gccaagaga
A0A493U0E8_MCL1-01      tgctggcaaggaaaccacactcgggggagcaggggggggtcaccgttgag
A0A493T1X3_BCL2-01      cgct-------------------------------------accagcggg
A0A493TIA6_BCL2L1-      aggt-------------------------------------accgccggg
                         * *                                      **      

A0A493SSZ7_BCL2A1-      attt----------------------------------------------
A0A493U0E8_MCL1-01      gatttgggacgttcccttggaatgcttcggaagctggaaatcaagaagga
A0A493T1X3_BCL2-01      acttcgc----------ccagatgtccggccagctgcacctgacgccctt
A0A493TIA6_BCL2L1-      ctttcag----------cgacctcacctcccagctccacatcacccccgg
                          **                                              

A0A493SSZ7_BCL2A1-      ---------------------tcaatggtgtcatggatgaaaaatttgct
A0A493U0E8_MCL1-01      ggaggacctgcagg----ccgtgggtgaggtggcggcccacctcttcagc
A0A493T1X3_BCL2-01      cacgg----ccagaggccgcttcgtggccgtggtggaggagctcttccga
A0A493TIA6_BCL2L1-      cacggcttaccaga----gcttcgagcaggtggtgaacgaacttttccgc
                                             *       **   *    *    **    

A0A493SSZ7_BCL2A1-      gatggaaatactaattggggaagaattacgaccatatttacttttgg---
A0A493U0E8_MCL1-01      gacggggtgaccaactgggggcgcgtcgtcaccctcatctccttcggcgc
A0A493T1X3_BCL2-01      gacggggtg---aactggggccggatcgtggccttcttcgagttcgg---
A0A493TIA6_BCL2L1-      gatggggtg---aactgggggcgcatcgtggccttcttctccttcgg---
                        ** **       ** *****  *  *     ** *  *    ** **   

A0A493SSZ7_BCL2A1-      -----gggtcttctcactaagaagcttcaagaacatggagttcagctcac
A0A493U0E8_MCL1-01      cttcgtcgcccggcacctgaaaagcgtaaagca---ggaga---------
A0A493T1X3_BCL2-01      ---cggcgtcatgtgcgtggagagcgtcaaccg---ggagatgtctcccc
A0A493TIA6_BCL2L1-      ---aggggcgctgtgcgtggagagcgtggacaa---ggagatgagggtcc
                               *         *    *** *  *      ****          

A0A493SSZ7_BCL2A1-      tggagagaagaaggagcaga-tctcttatttcatcacagag----tacat
A0A493U0E8_MCL1-01      ------aaagcatcggctccctggccaggatcatcaccgac----gccct
A0A493T1X3_BCL2-01      tggtggacagcatcg------ccgcctggatgaccgagtacctgaaccgg
A0A493TIA6_BCL2L1-      tggtggggcgcatcg------tggcctggatgaccacctacctgagcgac
                                 * *            *     * * *    *          

A0A493SSZ7_BCL2A1-      cataaacaataaagccgaatggatagatgcaaatggtggctgggaaaat-
A0A493U0E8_MCL1-01      cgtctcgtccaaacgcgagtggctcgtgagccagggaggctgggagggtt
A0A493T1X3_BCL2-01      cacctg-------cacaactggatccaggacaacggaggctgggatgcct
A0A493TIA6_BCL2L1-      cacctc-------gacccctggatccaggagaacggcggatggg------
                        *              *   *** *        * ** ** ****      

A0A493SSZ7_BCL2A1-      -------ggcttcctaacaaagtttgaaa------gaagatcactactgt
A0A493U0E8_MCL1-01      tcgtcgactttttccg----agtggaagacc--tggaaggcagcatcagg
A0A493T1X3_BCL2-01      tcgtggagttgtatggcaacagtatgaggcctttgttcgatttctcctgg
A0A493TIA6_BCL2L1-      taagggggtgctccttctgcact------cctctgggggatctgggctgg
                                   *        * *               *       * * 

A0A493SSZ7_BCL2A1-      cttt------------ctccaaaattacagacttattcgtggct------
A0A493U0E8_MCL1-01      aacg------------tgctgatg--gcgttcgcaggagtggctggactg
A0A493T1X3_BCL2-01      atct------------ctctgaag--actatcctgagtttggttctggtg
A0A493TIA6_BCL2L1-      atctggccccttagtgctctgcag--ataaccccccccccccgccccccc
                                          *            *                  

A0A493SSZ7_BCL2A1-      -------gttttttccttgt------------------------------
A0A493U0E8_MCL1-01      ggagcgagcttggcct----------------------------------
A0A493T1X3_BCL2-01      ggagcttgcatcactcttgg------------------------------
A0A493TIA6_BCL2L1-      cccccccgcacccccccccgccccctccccctccctccctctctccctcc
                               *                                          

A0A493SSZ7_BCL2A1-      -----------------tcagagagtag
A0A493U0E8_MCL1-01      --------------acatgatccggtga
A0A493T1X3_BCL2-01      --cgcttatctcggacataag----tag
A0A493TIA6_BCL2L1-      ctccctccctccaggcctgggcttttaa
                                         *       *  

© 1998-2019