Dataset for CDS BCL2L1 of organism Amphiprion ocellaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q1BQA0_BCL2L1-      atgtcgtacagtaacagagagctggtggagttctttgtaagcgacaagct
A0A3Q1DHJ3_BCL2L1-      atgtctca---gaacagagaactggtggttttctacataaagtataaact
A0A3Q1DHJ3_BCL2L1-      atgtctca---gaacagagaactggtggttttctacataaagtataaact
A0A3Q1DHJ3_BCL2L1-      atgtctca---gaacagagaactggtggttttctacataaagtataaact
                        *****  *    ******** *******  ****   ***   * ** **

A0A3Q1BQA0_BCL2L1-      gtctcaaaggaactatccgacgtctctgc----tgaggccagaggatgct
A0A3Q1DHJ3_BCL2L1-      ctcccagagaaactatcc----cctcaaccacatggtgctgaatgaggct
A0A3Q1DHJ3_BCL2L1-      ctcccagagaaactatcc----cctcaaccacatggtgctgaatgaggct
A0A3Q1DHJ3_BCL2L1-      ctcccagagaaactatcc----cctcaaccacatggtgctgaatgaggct
                         ** ** ** ********     ***  *    **  **   * ** ***

A0A3Q1BQA0_BCL2L1-      ggaggaaggactgatggggacaagg-ccaact----------cagcttcc
A0A3Q1DHJ3_BCL2L1-      cccagcaggactgacgggggggaggcccggctgggagaggaacagcggac
A0A3Q1DHJ3_BCL2L1-      cccagcaggactgacgggggggaggcccggctgggagaggaacagcggac
A0A3Q1DHJ3_BCL2L1-      cccagcaggactgacgggggggaggcccggctgggagaggaacagcggac
                            * ******** ****   *** **  **          ****   *

A0A3Q1BQA0_BCL2L1-      ag----------------------taatggcttgc---------------
A0A3Q1DHJ3_BCL2L1-      agagacacacgccaacgggacttttaacggcacgagtcccgggacccccc
A0A3Q1DHJ3_BCL2L1-      agagacacacgccaacgggacttttaacggcacgagtcccgggacccccc
A0A3Q1DHJ3_BCL2L1-      agagacacacgccaacgggacttttaacggcacgagtcccgggacccccc
                        **                      *** ***  *                

A0A3Q1BQA0_BCL2L1-      -----------tggtgaacagcagaggtgg----catagaggctgtaaaa
A0A3Q1DHJ3_BCL2L1-      cgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtgaag
A0A3Q1DHJ3_BCL2L1-      cgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtgaag
A0A3Q1DHJ3_BCL2L1-      cgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtgaag
                                    ** *    **   *  **    *** ** ** ** ** 

A0A3Q1BQA0_BCL2L1-      tccgcacttaaggacgcggcagatgagtttgaacttctcttcacgcaggc
A0A3Q1DHJ3_BCL2L1-      gaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgc
A0A3Q1DHJ3_BCL2L1-      gaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgc
A0A3Q1DHJ3_BCL2L1-      gaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgc
                           ** **   **** ****  * ***** ** ** *  * * * *  **

A0A3Q1BQA0_BCL2L1-      ttttagtgatctgtcttcacagcttgacatcacccctgaaacggcctacc
A0A3Q1DHJ3_BCL2L1-      cttcagcgacctgcacagccagctgcacatcacgcccgccaccgcctacc
A0A3Q1DHJ3_BCL2L1-      cttcagcgacctgcacagccagctgcacatcacgcccgccaccgcctacc
A0A3Q1DHJ3_BCL2L1-      cttcagcgacctgcacagccagctgcacatcacgcccgccaccgcctacc
                         ** ** ** ***      *****  ******* ** *  ** *******

A0A3Q1BQA0_BCL2L1-      acagctttaagagtgtgatggacgaggtgttcaaggatggggtcaactgg
A0A3Q1DHJ3_BCL2L1-      agagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactgg
A0A3Q1DHJ3_BCL2L1-      agagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactgg
A0A3Q1DHJ3_BCL2L1-      agagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactgg
                        * *****  ***  ******************  *** ** *********

A0A3Q1BQA0_BCL2L1-      ggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatg
A0A3Q1DHJ3_BCL2L1-      ggccgcatcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtg
A0A3Q1DHJ3_BCL2L1-      ggccgcatcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtg
A0A3Q1DHJ3_BCL2L1-      ggccgcatcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtg
                        ** ** ** ***** *****    ** ***** *  ******** ** **

A0A3Q1BQA0_BCL2L1-      cgtagagaagaatatgagtgagctggttccccgcatcgctgactggatga
A0A3Q1DHJ3_BCL2L1-      cgtggagaaggagatgagccccctggtgggcaggatcgtagagtggatga
A0A3Q1DHJ3_BCL2L1-      cgtggagaaggagatgagccccctggtgggcaggatcgtagagtggatga
A0A3Q1DHJ3_BCL2L1-      cgtggagaaggagatgagccccctggtgggcaggatcgtagagtggatga
                        *** ****** * *****    *****   * * ****  ** *******

A0A3Q1BQA0_BCL2L1-      ccatgtacctggatgagcacatcagtccgtggatccaaagccaaggagga
A0A3Q1DHJ3_BCL2L1-      ccgtctacctggacaaccacattcaggactggatccagagccaaggagga
A0A3Q1DHJ3_BCL2L1-      ccgtctacctggacaaccacattcaggactggatccagagccaaggagga
A0A3Q1DHJ3_BCL2L1-      ccgtctacctggacaaccacattcaggactggatccagagccaaggagga
                        ** * ********  * *****       ******** ************

A0A3Q1BQA0_BCL2L1-      tgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacg
A0A3Q1DHJ3_BCL2L1-      tgggagcgttttgctgaaatcttcggtcaggacgcggcggctgagagcag
A0A3Q1DHJ3_BCL2L1-      tgggagcgttttgctgaaatcttcggtcaggacgcggcggctgagagcag
A0A3Q1DHJ3_BCL2L1-      tgggagcgttttgctgaaatcttcggtcaggacgcggcggctgagagcag
                        ****** * ******** ** ** ** *** **** ** ** **     *

A0A3Q1BQA0_BCL2L1-      aaggtctcgggatactctgaagagatggctgctagtcggaggggtgctgc
A0A3Q1DHJ3_BCL2L1-      gaagtctcaggagagcttcaagaagtggctgctggtggggatgacggtgg
A0A3Q1DHJ3_BCL2L1-      gaagtctcaggagagcttcaagaagtggctgctggtggggatgacggtgg
A0A3Q1DHJ3_BCL2L1-      gaagtctcaggagagcttcaagaagtggctgctggtggggatgacggtgg
                         * ***** *** *   * ****  ******** ** **   *  * ** 

A0A3Q1BQA0_BCL2L1-      taatgggagttctggctggtgtgctcattgctaagaaaca---gtga
A0A3Q1DHJ3_BCL2L1-      tgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
A0A3Q1DHJ3_BCL2L1-      tgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
A0A3Q1DHJ3_BCL2L1-      tgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
                        * * *** **  ***  **    ***** **  ******    ****

© 1998-2019