Dataset for CDS MCL-1 of organism Amphilophus citrinellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      atgaacacgtgtactatgaggaattgtcgaatgggctcgtataaaaatgt
                                                                          

A0A3Q0R633_MCL1-01      ----------tctcttcctt------------------------------
A0A3Q0R633_MCL1-03      catggacctttttcttcctcaaaatggagtcgtggacggaacaatgcact
                                  * *******                               

A0A3Q0R633_MCL1-01      ------------------------------------ttacatccccagac
A0A3Q0R633_MCL1-03      atggatcggggaattcctctccgcaagatgccacaggtacacctaaagac
                                                             **** *   ****

A0A3Q0R633_MCL1-01      tccaatggtaccccaaaacggccgaacaacctgggggtggtatcaacaaa
A0A3Q0R633_MCL1-03      tccaatggtaccccaaaacggccgaacaacctgggggtggtatcaacaaa
                        **************************************************

A0A3Q0R633_MCL1-01      cggatatgcaccaaaaaatatcacggacgacgtggaagacggttcgttgc
A0A3Q0R633_MCL1-03      cggatatgcaccaaaaaatatcacggacgacgtggaagacggttcgttgc
                        **************************************************

A0A3Q0R633_MCL1-01      cgagcaccccggagtttcattcggatagtgaatccgacgaggcgctggag
A0A3Q0R633_MCL1-03      cgagcaccccggagtttcattcggatagtgaatccgacgaggcgctggag
                        **************************************************

A0A3Q0R633_MCL1-01      agggaaacgaaaagcctcattactagtttctttagagactttactggact
A0A3Q0R633_MCL1-03      agggaaacgaaaagcctcattactagtttctttagagactttactggact
                        **************************************************

A0A3Q0R633_MCL1-01      ttctcaacgacgatggaaagaaagcgaagcactaaaaacaatgaaaagag
A0A3Q0R633_MCL1-03      ttctcaacgacgatggaaagaaagcgaagcactaaaaacaatgaaaagag
                        **************************************************

A0A3Q0R633_MCL1-01      ttgtggcggacgtattagaaaagcaccgatacgcatacaacggaatggtc
A0A3Q0R633_MCL1-03      ttgtggcggacgtattagaaaagcaccgatacgcatacaacggaatggtc
                        **************************************************

A0A3Q0R633_MCL1-01      aacaaattgtcattggatgaaagaggggaggacgtgacatttgtgagcgc
A0A3Q0R633_MCL1-03      aacaaattgtcattggatgaaagaggggaggacgtgacatttgtgagcgc
                        **************************************************

A0A3Q0R633_MCL1-01      ggtagccaagagcctgtttgcagacaaaaccaccaactggggtcgtattg
A0A3Q0R633_MCL1-03      ggtagccaagagcctgtttgcagacaaaaccaccaactggggtcgtattg
                        **************************************************

A0A3Q0R633_MCL1-01      ccagtctgatggcctttggggcagtggtgtgtcagcgcttgaaggaaaaa
A0A3Q0R633_MCL1-03      ccagtctgatggcctttggggcagtggtgtgtcagcgcttgaaggaaaaa
                        **************************************************

A0A3Q0R633_MCL1-01      ggcagggacaattgtgtggagctggtgagccaggagatttccacatacct
A0A3Q0R633_MCL1-03      ggcagggacaattgtgtggagctggtgagccaggagatttccacatacct
                        **************************************************

A0A3Q0R633_MCL1-01      gctgtctgaccaacgagactggctggttaaaaacaatgcatgggatggat
A0A3Q0R633_MCL1-03      gctgtctgaccaacgagactggctggttaaaaacaatgcatgggatggat
                        **************************************************

A0A3Q0R633_MCL1-01      ttgtggagttttttcgtgtagcagaccccgagtcaacagtgaggaacaca
A0A3Q0R633_MCL1-03      ttgtggagttttttcgtgtagcagaccccgagtcaacagtgaggaacaca
                        **************************************************

A0A3Q0R633_MCL1-01      ctcatggcctttgctggatttgctggtattggggcaacactggccctgtt
A0A3Q0R633_MCL1-03      ctcatggcctttgctggatttgctggtattggggcaacactggccctgtt
                        **************************************************

A0A3Q0R633_MCL1-01      gatcaggtga
A0A3Q0R633_MCL1-03      gatcaggtga
                        **********

© 1998-2019