Dataset for CDS MCL-1 of organism Amphilophus citrinellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q0RA11_MCL1-02      --------------------------------------------------
A0A3Q0RA11_MCL1-03      atgaacacgtgtactatgaggaattgtcgaatgggctcgtataaaaatgt
A0A3Q0RA11_MCL1-01      --------------------------------------------------
                                                                          

A0A3Q0RA11_MCL1-02      --------------------------------------------------
A0A3Q0RA11_MCL1-03      catggacctttttcttcctcaaaatggagtcgtggacggaacaatgcact
A0A3Q0RA11_MCL1-01      ----------tctcttcctt------------------------------
                                                                          

A0A3Q0RA11_MCL1-02      --------------------------------------------------
A0A3Q0RA11_MCL1-03      atggatcggggaattcctctccgcaagatgccacaggtacacctaaagac
A0A3Q0RA11_MCL1-01      ------------------------------------ttacatccccagac
                                                                          

A0A3Q0RA11_MCL1-02      -----------------atgcctgagagaaatggtagtgctatatcaac-
A0A3Q0RA11_MCL1-03      tccaatggtaccccaaaacggccgaacaacctgggggtg--gtatcaaca
A0A3Q0RA11_MCL1-01      tccaatggtaccccaaaacggccgaacaacctgggggtg--gtatcaaca
                                         * * * **   *  ***  ***   ******* 

A0A3Q0RA11_MCL1-02      --------------------------------------------------
A0A3Q0RA11_MCL1-03      aacggatatgcaccaaaaaatatcacggacgacgtggaagacggttcgtt
A0A3Q0RA11_MCL1-01      aacggatatgcaccaaaaaatatcacggacgacgtggaagacggttcgtt
                                                                          

A0A3Q0RA11_MCL1-02      ------------------tcagttggg-----------------------
A0A3Q0RA11_MCL1-03      gccgagcaccccggagtttcattcggatagtgaatccgacgaggcgctgg
A0A3Q0RA11_MCL1-01      gccgagcaccccggagtttcattcggatagtgaatccgacgaggcgctgg
                                          *** * **                        

A0A3Q0RA11_MCL1-02      --------------------attac-----------------atcctagg
A0A3Q0RA11_MCL1-03      agagggaaacgaaaagcctcattactagtttctttagagactttactgga
A0A3Q0RA11_MCL1-01      agagggaaacgaaaagcctcattactagtttctttagagactttactgga
                                            *****                  * ** * 

A0A3Q0RA11_MCL1-02      atttct--------------------------------------------
A0A3Q0RA11_MCL1-03      ctttctcaacgacgatggaaagaaagcgaagcactaaaaacaatgaaaag
A0A3Q0RA11_MCL1-01      ctttctcaacgacgatggaaagaaagcgaagcactaaaaacaatgaaaag
                         *****                                            

A0A3Q0RA11_MCL1-02      -------------------------------------------ggaatgg
A0A3Q0RA11_MCL1-03      agttgtggcggacgtattagaaaagcaccgatacgcatacaacggaatgg
A0A3Q0RA11_MCL1-01      agttgtggcggacgtattagaaaagcaccgatacgcatacaacggaatgg
                                                                   *******

A0A3Q0RA11_MCL1-02      tcaacaaattgtcattggatgaaagaggggaggacgtgacatttgtgagc
A0A3Q0RA11_MCL1-03      tcaacaaattgtcattggatgaaagaggggaggacgtgacatttgtgagc
A0A3Q0RA11_MCL1-01      tcaacaaattgtcattggatgaaagaggggaggacgtgacatttgtgagc
                        **************************************************

A0A3Q0RA11_MCL1-02      gcggtagccaagagcctgtttgcagacaaaaccaccaactggggtcgtat
A0A3Q0RA11_MCL1-03      gcggtagccaagagcctgtttgcagacaaaaccaccaactggggtcgtat
A0A3Q0RA11_MCL1-01      gcggtagccaagagcctgtttgcagacaaaaccaccaactggggtcgtat
                        **************************************************

A0A3Q0RA11_MCL1-02      tgccagtctgatggcctttggggcagtggtgtgtcagcgcttgaaggaaa
A0A3Q0RA11_MCL1-03      tgccagtctgatggcctttggggcagtggtgtgtcagcgcttgaaggaaa
A0A3Q0RA11_MCL1-01      tgccagtctgatggcctttggggcagtggtgtgtcagcgcttgaaggaaa
                        **************************************************

A0A3Q0RA11_MCL1-02      aaggcagggacaattgtgtggagctggtgagccaggagatttccacatac
A0A3Q0RA11_MCL1-03      aaggcagggacaattgtgtggagctggtgagccaggagatttccacatac
A0A3Q0RA11_MCL1-01      aaggcagggacaattgtgtggagctggtgagccaggagatttccacatac
                        **************************************************

A0A3Q0RA11_MCL1-02      ctgctgtctgaccaacgagactggctggttaaaaacaatgcatgggatgg
A0A3Q0RA11_MCL1-03      ctgctgtctgaccaacgagactggctggttaaaaacaatgcatgggatgg
A0A3Q0RA11_MCL1-01      ctgctgtctgaccaacgagactggctggttaaaaacaatgcatgggatgg
                        **************************************************

A0A3Q0RA11_MCL1-02      atttgtggagttttttcgtgtagcagaccccgagtcaacagtgaggaaca
A0A3Q0RA11_MCL1-03      atttgtggagttttttcgtgtagcagaccccgagtcaacagtgaggaaca
A0A3Q0RA11_MCL1-01      atttgtggagttttttcgtgtagcagaccccgagtcaacagtgaggaaca
                        **************************************************

A0A3Q0RA11_MCL1-02      cactcatggcctttgctggatttgctggtattggggcaacactggccctg
A0A3Q0RA11_MCL1-03      cactcatggcctttgctggatttgctggtattggggcaacactggccctg
A0A3Q0RA11_MCL1-01      cactcatggcctttgctggatttgctggtattggggcaacactggccctg
                        **************************************************

A0A3Q0RA11_MCL1-02      ttgatcaggtga
A0A3Q0RA11_MCL1-03      ttgatcaggtga
A0A3Q0RA11_MCL1-01      ttgatcaggtga
                        ************

© 1998-2019