Dataset for CDS BCL-2-like of organism Amphilophus citrinellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      atgtctcaaaacagagaactggtgcttttctacataacgtataaactatc
A0A3Q0S9R1_BCL2L10      --------------------------------------------------
A0A3Q0RA11_MCL1-02      --------------------------------------------------
A0A3Q0RA11_MCL1-03      atgaacacgtgtactatgaggaattgtcgaatgggctcgtataaaaatgt
A0A3Q0RA11_MCL1-01      --------------------------------------------------
                                                                          

A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      ccagagaaactatcctctcaaccac-------------------------
A0A3Q0S9R1_BCL2L10      --------------------------------------------------
A0A3Q0RA11_MCL1-02      --------------------------------------------------
A0A3Q0RA11_MCL1-03      catggacctttttcttcctcaaaatggagtcgtggacggaacaatgcact
A0A3Q0RA11_MCL1-01      ----------tctcttcctt------------------------------
                                                                          

A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A3Q0S9R1_BCL2L10      --------------------------------------------------
A0A3Q0RA11_MCL1-02      --------------------------------------------------
A0A3Q0RA11_MCL1-03      atggatcggggaattcctctccgcaagatgccacaggtacacctaaagac
A0A3Q0RA11_MCL1-01      ------------------------------------ttacatccccagac
                                                                          

A0A3Q0S5Z7_BCL2-01      ----atgg---cgaacgagtataatcgcaatattgtggaaaagtatatct
A0A3Q0RTF8_BCL2L1-      ----atagtactcaacgagccttcgaacaggactgatgggggg-gcagc-
A0A3Q0S9R1_BCL2L10      ----atggt--cc--------------ctgggctgtggaaagaaaccct-
A0A3Q0RA11_MCL1-02      -------------------------------atgcctgagaga---aat-
A0A3Q0RA11_MCL1-03      tccaatggtaccc--------------caaaacggccgaacaa---cct-
A0A3Q0RA11_MCL1-01      tccaatggtaccc--------------caaaacggccgaacaa---cct-
                                                             *            

A0A3Q0S5Z7_BCL2-01      gccataaactctccaaacggggatacgcgtggggatttgacggtgtccag
A0A3Q0RTF8_BCL2L1-      --------------------agggttggatgaggaac-------------
A0A3Q0S9R1_BCL2L10      --------------------gggtttggctgaggactacctgtctctgtg
A0A3Q0RA11_MCL1-02      --------------------ggtagtgctatatcaac-------------
A0A3Q0RA11_MCL1-03      --------------------gggggtg--gtatcaacaaacggatatgca
A0A3Q0RA11_MCL1-01      --------------------gggggtg--gtatcaacaaacggatatgca
                                             *    *       *               

A0A3Q0S5Z7_BCL2-01      gatgaagatgctgctaataacgggtc------------aataaatgaccc
A0A3Q0RTF8_BCL2L1-      --------------------------------------agcgaatagata
A0A3Q0S9R1_BCL2L10      ctgcacaagtccac------------------------atcaagtccctc
A0A3Q0RA11_MCL1-02      --------------------------------------------------
A0A3Q0RA11_MCL1-03      ccaaaaaatatcacggacgacgtggaagacggttcgttgccgagcacccc
A0A3Q0RA11_MCL1-01      ccaaaaaatatcacggacgacgtggaagacggttcgttgccgagcacccc
                                                                          

A0A3Q0S5Z7_BCL2-01      tccaccgactttggtccgccggtgccgaga---------acccagcaacg
A0A3Q0RTF8_BCL2L1-      cacacgccaatgggacttttaatggcacaagtc-ccggtaccccgccagc
A0A3Q0S9R1_BCL2L10      cacctcccagcgagtcagccgctgccatgagacgtctgggccaggatatt
A0A3Q0RA11_MCL1-02      ------tcagttggg-----------------------------------
A0A3Q0RA11_MCL1-03      ggagtttcattcggatagtgaatccgacgaggcgctggag--agggaaac
A0A3Q0RA11_MCL1-01      ggagtttcattcggatagtgaatccgacgaggcgctggag--agggaaac
                                     *                                    

A0A3Q0S5Z7_BCL2-01      ggcctgacggcgagagcaacacccacctctgcagacggctcccacagtcc
A0A3Q0RTF8_BCL2L1-      gtccccgcagcggcagcaacagccgc-catcaaca---------------
A0A3Q0S9R1_BCL2L10      g-------agcggcagcaccaggctcgctttgaca---------------
A0A3Q0RA11_MCL1-02      -----------------attac----------------------------
A0A3Q0RA11_MCL1-03      g-------aaaagcctcattactagtttctttaga---------------
A0A3Q0RA11_MCL1-01      g-------aaaagcctcattactagtttctttaga---------------
                                         *  *                             

A0A3Q0S5Z7_BCL2-01      gacccacacgcagacatccacagagt---------cctgcgagaggctgg
A0A3Q0RTF8_BCL2L1-      -ac--------gaacctcgacgcagtgaaggaggcgctccgggacacagc
A0A3Q0S9R1_BCL2L10      -accttgctcagaccttcc-------------------------------
A0A3Q0RA11_MCL1-02      -----atcctaggatttct-------------------------------
A0A3Q0RA11_MCL1-03      -gactttactggactttctcaacgacgatggaaagaaagcgaagcactaa
A0A3Q0RA11_MCL1-01      -gactttactggactttctcaacgacgatggaaagaaagcgaagcactaa
                                        **                                

A0A3Q0S5Z7_BCL2-01      agatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggc
A0A3Q0RTF8_BCL2L1-      caacgagttcgagctgcgatacgctcgtgccttcaacgatctgcacagcc
A0A3Q0S9R1_BCL2L10      -----------tgaggcattgcgggc----------c-----ggatcact
A0A3Q0RA11_MCL1-02      --------------------------------------------------
A0A3Q0RA11_MCL1-03      aaacaatgaaaagagttgtggcggacgtattagaaaa-----gcaccgat
A0A3Q0RA11_MCL1-01      aaacaatgaaaagagttgtggcggacgtattagaaaa-----gcaccgat
                                                                          

A0A3Q0S5Z7_BCL2-01      agctgcatctcacctccgcca------------cggcgcagaggagattc
A0A3Q0RTF8_BCL2L1-      agctgcacatcacgccggcca------------cggcctaccaaagcttc
A0A3Q0S9R1_BCL2L10      gctctagcctcaggaaggtga------------tgg---aggagctggtg
A0A3Q0RA11_MCL1-02      -----------ggaatggtcaacaaattgtcattgg---atgaaagaggg
A0A3Q0RA11_MCL1-03      acgcatacaacggaatggtcaacaaattgtcattgg---atgaaagaggg
A0A3Q0RA11_MCL1-01      acgcatacaacggaatggtcaacaaattgtcattgg---atgaaagaggg
                                         *  *             **   *          

A0A3Q0S5Z7_BCL2-01      gccgaggtga---------tagacgaac------------tgttccggga
A0A3Q0RTF8_BCL2L1-      gagaatgtga---------tggacgagg------------tgttccggga
A0A3Q0S9R1_BCL2L10      ggagacg-gacacttgaactgggggagg--gttgtttccctttttg----
A0A3Q0RA11_MCL1-02      gaggacgtgacatttg---tgagcgcggtagccaagagcctgtttgcaga
A0A3Q0RA11_MCL1-03      gaggacgtgacatttg---tgagcgcggtagccaagagcctgtttgcaga
A0A3Q0RA11_MCL1-01      gaggacgtgacatttg---tgagcgcggtagccaagagcctgtttgcaga
                        *   * * **         *    *               * **      

A0A3Q0S5Z7_BCL2-01      cgg---agtgaactggggccggattattgctttcttcgagtttgggggca
A0A3Q0RTF8_BCL2L1-      tgg---cgtcaactggggccgcatcgtagggcttttcgcgttcggcgggg
A0A3Q0S9R1_BCL2L10      ------cttttactgggg------tgctagccagaaagaggctggagcag
A0A3Q0RA11_MCL1-02      caaaaccaccaactggggtcgtattgccagtctgatggcctttggggcag
A0A3Q0RA11_MCL1-03      caaaaccaccaactggggtcgtattgccagtctgatggcctttggggcag
A0A3Q0RA11_MCL1-01      caaaaccaccaactggggtcgtattgccagtctgatggcctttggggcag
                                   *******                   *     ** *   

A0A3Q0S5Z7_BCL2-01      cggtgtgc-----gtggagtgcgcttccaacgagggg-------atgaca
A0A3Q0RTF8_BCL2L1-      cactgtgt-----gtcgagtgtgtcgagaaggag----------atgagc
A0A3Q0S9R1_BCL2L10      ----aagccagggctggaccctgggcaacagcaggaactgggacaggagc
A0A3Q0RA11_MCL1-02      tggtgtgtcagcgcttgaa---ggaaaaaggcagggac------------
A0A3Q0RA11_MCL1-03      tggtgtgtcagcgcttgaa---ggaaaaaggcagggac------------
A0A3Q0RA11_MCL1-01      tggtgtgtcagcgcttgaa---ggaaaaaggcagggac------------
                              *       * **    *         **                

A0A3Q0S5Z7_BCL2-01      tcgcaggtggacaacatc--gcag---agtggatgacggagtatttaaat
A0A3Q0RTF8_BCL2L1-      cccctggtgggcaggatc--gtag---agtggatgacagtctacctagac
A0A3Q0S9R1_BCL2L10      ccataagctgcagggagctggcag---agaccatagctgattacctgggg
A0A3Q0RA11_MCL1-02      -----aattgtgtggagctggtgagccaggagatttccacatacctgctg
A0A3Q0RA11_MCL1-03      -----aattgtgtggagctggtgagccaggagatttccacatacctgctg
A0A3Q0RA11_MCL1-01      -----aattgtgtggagctggtgagccaggagatttccacatacctgctg
                                 *     * *  *      **   **  *    **  *    

A0A3Q0S5Z7_BCL2-01      ggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
A0A3Q0RTF8_BCL2L1-      aaccacattcagccctggatccagagccaaggaggatgggagcgctttgc
A0A3Q0S9R1_BCL2L10      gaagagaagaaagactggctcttggacaatgatggatgggagggtttctg
A0A3Q0RA11_MCL1-02      tctgaccaacgagactggctggttaaaaacaatgcatgggatggatttgt
A0A3Q0RA11_MCL1-03      tctgaccaacgagactggctggttaaaaacaatgcatgggatggatttgt
A0A3Q0RA11_MCL1-01      tctgaccaacgagactggctggttaaaaacaatgcatgggatggatttgt
                                      **** *        *    * ******    **   

A0A3Q0S5Z7_BCL2-01      ggagctgt--------------atggcagacagagggagtccgtcttcag
A0A3Q0RTF8_BCL2L1-      tgaaatctttgggcaggacgcggcggctgaaagccggaggtc--------
A0A3Q0S9R1_BCL2L10      taagtactcc--------cgcagtgccagagaggtgag------------
A0A3Q0RA11_MCL1-02      ggagtttttt--------cgt-gtagcaga--------------------
A0A3Q0RA11_MCL1-03      ggagtttttt--------cgt-gtagcaga--------------------
A0A3Q0RA11_MCL1-01      ggagtttttt--------cgt-gtagcaga--------------------
                          *    *                  * **                    

A0A3Q0S5Z7_BCL2-01      ttgctcctggccctccatcaaga---cagttttcggcttggctgcac---
A0A3Q0RTF8_BCL2L1-      ---tcaggagagcttcaagaagtggctgcttgtgggcatgacggtggtga
A0A3Q0S9R1_BCL2L10      ---ccaggactcttccatgaagaccgcgct------gtttgctg---ctg
A0A3Q0RA11_MCL1-02      ---ccccgagtcaacagtgaggaacacactcatggcctttgctggatttg
A0A3Q0RA11_MCL1-03      ---ccccgagtcaacagtgaggaacacactcatggcctttgctggatttg
A0A3Q0RA11_MCL1-01      ---ccccgagtcaacagtgaggaacacactcatggcctttgctggatttg
                                           * *       *        *  * *      

A0A3Q0S5Z7_BCL2-01      ------tcggagcggccagcctcaccatcggagcatatcttacacaaaag
A0A3Q0RTF8_BCL2L1-      ccggcgtcgtggcaggtgcactcatcgcg---------caaaaacgcctg
A0A3Q0S9R1_BCL2L10      ctggcgtcggcctggccgggcttactttc---------cttttggtgcgc
A0A3Q0RA11_MCL1-02      ctggtattgg---ggcaacactggc---c---------ctgttgatcagg
A0A3Q0RA11_MCL1-03      ctggtattgg---ggcaacactggc---c---------ctgttgatcagg
A0A3Q0RA11_MCL1-01      ctggtattgg---ggcaacactggc---c---------ctgttgatcagg
                              * *     *     **                *           

A0A3Q0S5Z7_BCL2-01      tga
A0A3Q0RTF8_BCL2L1-      tga
A0A3Q0S9R1_BCL2L10      tag
A0A3Q0RA11_MCL1-02      tga
A0A3Q0RA11_MCL1-03      tga
A0A3Q0RA11_MCL1-01      tga
                        *  

© 1998-2019