Dataset for CDS MCL-1 of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1L3M8_MCL1-01      atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccggg
G1L3M8_MCL1-02      atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccggg
                    ************************************************************

G1L3M8_MCL1-01      ttgggggccggcagcggcgggggggnatcgggagggcggcttttggcttcggggaaggag
G1L3M8_MCL1-02      ttgggggccggcagcggcgggggggnatcgggagggcggcttttggcttcggggaaggag
                    ************************************************************

G1L3M8_MCL1-01      gccacggcccggagggagatagggggaggggaagccggtgcggtgattggcggaagcgcc
G1L3M8_MCL1-02      gccacggcccggagggagatagggggaggggaagccggtgcggtgattggcggaagcgcc
                    ************************************************************

G1L3M8_MCL1-01      ggcgctagtcccccggn---------------------------------------tggc
G1L3M8_MCL1-02      ggcgctagtcccccggccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntggc
                    ****************                                        ****

G1L3M8_MCL1-01      gccgagggtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacccgc
G1L3M8_MCL1-02      gccgagggtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacccgc
                    ************************************************************

G1L3M8_MCL1-01      cgcgcgtcgccgcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaa
G1L3M8_MCL1-02      cgcgcgtcgccgcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaa
                    ************************************************************

G1L3M8_MCL1-01      gaggagctggacgggtacgagccggaacctttggggaagcggccggctgtcctgcctttg
G1L3M8_MCL1-02      gaggagctggacgggtacgagccggaacctttggggaagcggccggctgtcctgcctttg
                    ************************************************************

G1L3M8_MCL1-01      ctggagttggtcggggaggccagcggtggcccttgtacggacggctcactgccctcgacg
G1L3M8_MCL1-02      ctggagttggtcggggaggccagcggtggcccttgtacggacggctcactgccctcgacg
                    ************************************************************

G1L3M8_MCL1-01      ccacccccagcagaggaggaggaagacgagttgtaccggcagtcgctggagattatctct
G1L3M8_MCL1-02      ccacccccagcagaggaggaggaagacgagttgtaccggcagtcgctggagattatctct
                    ************************************************************

G1L3M8_MCL1-01      cggtaccttcgggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggg
G1L3M8_MCL1-02      cggtaccttcgggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggg
                    ************************************************************

G1L3M8_MCL1-01      gcggccagccggaaggcgttagagaccctccgacgggtcggggacggggtacagcgcaac
G1L3M8_MCL1-02      gcggccagccggaaggcgttagagaccctccgacgggtcggggacggggtacagcgcaac
                    ************************************************************

G1L3M8_MCL1-01      cacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaagacgatgtc
G1L3M8_MCL1-02      cacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaagacgatgtc
                    ************************************************************

G1L3M8_MCL1-01      aaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcagg
G1L3M8_MCL1-02      aaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcagg
                    ************************************************************

G1L3M8_MCL1-01      attgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaa
G1L3M8_MCL1-02      attgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaa
                    ************************************************************

G1L3M8_MCL1-01      gaaggctgcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacga
G1L3M8_MCL1-02      gaaggctgcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacga
                    ************************************************************

G1L3M8_MCL1-01      gactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggac
G1L3M8_MCL1-02      gactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggac
                    ************************************************************

G1L3M8_MCL1-01      ctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagct
G1L3M8_MCL1-02      ctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagct
                    ************************************************************

G1L3M8_MCL1-01      ggtttggcatatctaataagatag
G1L3M8_MCL1-02      ggtttggcatatctaataaga---
                    *********************   

© 1998-2018