Dataset for CDS BCL-2-like of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G1LMC3_BCL2L2-01       ccatatattcatgccagtctttcatccttgactcttacagccgcccggat
G1LID1_BCL2-02         -----------------------at-------------------------
G1LID1_BCL2-01         --------------------------------------------------
G1LKR4_BCL2L10-01      -----------------------at-------------------------
G1L3M8_MCL1-01         -----------------------atgtttggcctcaaaagaaacgcagta
G1L3M8_MCL1-02         -----------------------atgtttggcctcaaaagaaacgcagta

G1LMC3_BCL2L2-01       ggcgaccccagcttcagccccagacacacgggctctagtggc--------
G1LID1_BCL2-02         -----------ggcgcacgctgggagaacagggtatgataac-----cgg
G1LID1_BCL2-01         ------------ccccaccccg------cagcgt----------------
G1LKR4_BCL2L10-01      -----------------------ggcggacgcgttgaggggc----acgg
G1L3M8_MCL1-01         atcggactcaacctctactgtgggggggccgggttgggggccggcagcgg
G1L3M8_MCL1-02         atcggactcaacctctactgtgggggggccgggttgggggccggcagcgg
                                                     *  *                

G1LMC3_BCL2L2-01       -----------agactttgtaggctataagctgaggcagaaaggttatg-
G1LID1_BCL2-02         gagatagtgatgaagtacatccactataagctgtcgcagaggggctacga
G1LID1_BCL2-01         ---------------------ccccccggcccttcgt-gaggcgctg---
G1LKR4_BCL2L10-01      c-----------------gcggctgctgac--------------cgacta
G1L3M8_MCL1-01         cgggggggnatcgggagggcggcttttggcttcggggaaggaggccacgg
G1L3M8_MCL1-02         cgggggggnatcgggagggcggcttttggcttcggggaaggaggccacgg

G1LMC3_BCL2L2-01       --tgtgtggagctggccctggggagggcc---------------------
G1LID1_BCL2-02         gtgggatgccggagacgcggcccc-cgccgccgc----------------
G1LID1_BCL2-01         -------gcaggtggcgccgccaagcgccgccgc----------------
G1LKR4_BCL2L10-01      cctggag-----tactgcgcccgggagcc--------------cggcacc
G1L3M8_MCL1-01         cccggagggagatagggggaggggaagccggtgcggtgattggcggaa--
G1L3M8_MCL1-02         cccggagggagatagggggaggggaagccggtgcggtgattggcggaa--

G1LMC3_BCL2L2-01       ------cagcagctgacccact----------------------------
G1LID1_BCL2-02         ----cgccgccgcgggccct------------------------------
G1LID1_BCL2-01         ----cgccgccgcgggccct------------------------------
G1LKR4_BCL2L10-01      cctgcgcgggcgcc-gtcc-------------------------------
G1L3M8_MCL1-01         ---gcgccggcgctagtcccccggn-------------------------
G1L3M8_MCL1-02         ---gcgccggcgctagtcccccggccnnnnnnnnnnnnnnnnnnnnnnnn
                             * *  **    **                               

G1LMC3_BCL2L2-01       ----------------gcaccaag-----ccatgc---------------
G1LID1_BCL2-02         ----------------gcgctcag---ccccgtgccac---ctgtggtcc
G1LID1_BCL2-01         ----------------gcgctcag---ccccgtgccac---ctgtggtcc
G1LKR4_BCL2L10-01      ----------------acgcccgaggccgcggtgctgcgttcggtggccg
G1L3M8_MCL1-01         --------------tggcgccgagggtcccgacgtca----cggcgaccc
G1L3M8_MCL1-02         nnnnnnnnnnnnnntggcgccgagggtcccgacgtca----cggcgaccc
                                        * *         *   *                

G1LMC3_BCL2L2-01       --------------------------------------------------
G1LID1_BCL2-02         acctgaccctgc--------------------------------------
G1LID1_BCL2-01         acctgaccctgc--------------------------------------
G1LKR4_BCL2L10-01      cccaggtacagcagcgtcacgagcgcttcttgtccg-attaccgc-----
G1L3M8_MCL1-01         ccccgaggctactgttcctcgagcccacccgccgcgcgtcgccgcctgaa
G1L3M8_MCL1-02         ccccgaggctactgttcctcgagcccacccgccgcgcgtcgccgcctgaa

G1LMC3_BCL2L2-01       ----------gggcagctggagatgagtttgagacccgcttccggcgcac
G1LID1_BCL2-02         ----------gccaggccggcgatgacttctcccgtcgctaccgccgcga
G1LID1_BCL2-01         ----------gccaggccggcgatgacttctcccgtcgctaccgccgcga
G1LKR4_BCL2L10-01      ---------ggctacgccggcggcaac--cgcgtggagctggtggctcag
G1L3M8_MCL1-01         gagatggaaggcccagccgccgacgcc--atcatgtcgc------ccgaa
G1L3M8_MCL1-02         gagatggaaggcccagccgccgacgcc--atcatgtcgc------ccgaa
                                 *    ** *  *               **      *    

G1LMC3_BCL2L2-01       cttctctgatttgg-----------------------------cagcc--
G1LID1_BCL2-02         cttcgcggagatgtc----------------------------cagcc--
G1LID1_BCL2-01         cttcgcggagatgtc----------------------------cagcc--
G1LKR4_BCL2L10-01      ----gtggagcggga--gatactcgcccacccc----------cagcc--
G1L3M8_MCL1-01         ----gaggagctggacgggtacgagccggaacctttggggaagcggccgg
G1L3M8_MCL1-02         ----gaggagctggacgggtacgagccggaacctttggggaagcggccgg
                              **   *                              * ***  

G1LMC3_BCL2L2-01       -----------cagctgcatgtgac-------------------------
G1LID1_BCL2-02         ------------agctgcacctgac-------------------------
G1LID1_BCL2-01         ------------agctgcacctgac-------------------------
G1LKR4_BCL2L10-01      --------cctaagctggggccgt------------gtggtggc------
G1L3M8_MCL1-01         ctgtcctgcctttgctggagttggtcggggaggccagcggtggcccttgt
G1L3M8_MCL1-02         ctgtcctgcctttgctggagttggtcggggaggccagcggtggcccttgt
                                    ****     *                           

G1LMC3_BCL2L2-01       --------cccaggctcagcccagcaacgct-------------------
G1LID1_BCL2-02         -------acccttcacc-gcaaggggacgct-------------------
G1LID1_BCL2-01         -------acccttcacc-gcaaggggacgct-------------------
G1LKR4_BCL2L10-01      -------gctcttgaccttcgcgggcacact-------------------
G1L3M8_MCL1-01         acggacggctcactgccctcgacgccacccccagcagaggaggaggaaga
G1L3M8_MCL1-02         acggacggctcactgccctcgacgccacccccagcagaggaggaggaaga
                               * *     *  *   *  ** *                    

G1LMC3_BCL2L2-01       ----tcacccaggtctc------tgatgaactc--------ttccaagg-
G1LID1_BCL2-02         ----ttgccacggtggt------ggaggagctc--------ttcagggat
G1LID1_BCL2-01         ----ttgccacggtggt------ggaggagctc--------ttcagggat
G1LKR4_BCL2L10-01      ---gctggagagatcgccgtcggggacctactc---gaacct---ggggc
G1L3M8_MCL1-01         cgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagc
G1L3M8_MCL1-02         cgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagc
                                  *            **    ***        *        

G1LMC3_BCL2L2-01       --------------------gggccccaactggggccgcctggtgg----
G1LID1_BCL2-02         ggg-----------------gtga----actgggggaggattgtgg----
G1LID1_BCL2-01         ggg-----------------gtga----actgggggaggattgtgg----
G1LKR4_BCL2L10-01      cgg--------accaggaactgga----gctgggggagt---gggaggcc
G1L3M8_MCL1-01         aggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggcc
G1L3M8_MCL1-02         aggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggcc
                                             *      *****   *    * *     

G1LMC3_BCL2L2-01       --------------------ccttctttgtctt---------------tg
G1LID1_BCL2-02         --------------------ccttctttgagtt------------cggtg
G1LID1_BCL2-01         --------------------ccttctttgagtt------------cggtg
G1LKR4_BCL2L10-01      gg------------------cgtccgccaggac---------------tg
G1L3M8_MCL1-01         agccggaaggcgttagagaccctccgacgggtcggggacggggtacagcg
G1L3M8_MCL1-02         agccggaaggcgttagagaccctccgacgggtcggggacggggtacagcg
                                           * * *                        *

G1LMC3_BCL2L2-01       gagccgcactgtg-----------------tgctgagagtgtcaac----
G1LID1_BCL2-02         gggtcatgtg--------------------tgtggagagcgtcaac----
G1LID1_BCL2-01         gggtcatgtg--------------------tgtggagagcgtcaac----
G1LKR4_BCL2L10-01      ccggcacctggtggacttcc----------tctgcaatcggctcac----
G1L3M8_MCL1-01         caaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaa
G1L3M8_MCL1-02         caaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaa
                           *                         *    *    *    *    

G1LMC3_BCL2L2-01       ---aaagagatggaaccact-----------tgtgggacaagt-------
G1LID1_BCL2-02         ---cgggagatgtcgcccct-----------ggtggacaacattgcc---
G1LID1_BCL2-01         ---cgggagatgtcgcccct-----------ggtggacaacattgcc---
G1LKR4_BCL2L10-01      ---gggacagcatcgcgcct-------ggctggaggcgca---------c
G1L3M8_MCL1-01         atgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagt
G1L3M8_MCL1-02         atgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagt
                                         **              **   *          

G1LMC3_BCL2L2-01       --------------gcaagagtggatggtggc---------------cta
G1LID1_BCL2-02         --------------ctgtgg-------atgac------------tgagta
G1LID1_BCL2-01         --------------ctgtgg-------atgac------------tgagta
G1LKR4_BCL2L10-01      gacgg---------ctggg--------atggcttttgtctcttcttcaca
G1L3M8_MCL1-01         gacggagtaacaaactggggcaggattgtgactcttatttctt-ttggtg
G1L3M8_MCL1-02         gacggagtaacaaactggggcaggattgtgactcttatttctt-ttggtg
                                         *         ** *                  

G1LMC3_BCL2L2-01       cctggagacacggctggctgactgga------------------------
G1LID1_BCL2-02         cctgaaccggcacctgcacacctgga------------------------
G1LID1_BCL2-01         cctgaaccggcacctgcacacctgga------------------------
G1LKR4_BCL2L10-01      cccatgctg----ccgtcgtcttggaaa----------------------
G1L3M8_MCL1-01         cctttgtgg----ccaaacacttgaagagtataaaccaagaaggctgcat
G1L3M8_MCL1-02         cctttgtgg----ccaaacacttgaagagtataaaccaagaaggctgcat
                       **           *        ** *                        

G1LMC3_BCL2L2-01       --------------------------------------------------
G1LID1_BCL2-02         --------------------------------------------------
G1LID1_BCL2-01         --------------------------------------------------
G1LKR4_BCL2L10-01      ------------------------------------------------ag
G1L3M8_MCL1-01         cgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgag
G1L3M8_MCL1-02         cgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgag

G1LMC3_BCL2L2-01       ----tccacagcagt--gggggctgggcggagttcacagctct------a
G1LID1_BCL2-02         ----tccaggacaac--ggaggctgg-----------gtaggtgcacgtc
G1LID1_BCL2-01         ----tccaggacaac--ggaggctgggatgcctttgtggagttgtacggc
G1LKR4_BCL2L10-01      act-gctggccca--------------------------ggct------c
G1L3M8_MCL1-01         actggctagtcaaacaaagaggctgggatgggtttgtggagtt------c
G1L3M8_MCL1-02         actggctagtcaaacaaagaggctgggatgggtttgtggagtt------c
                            *      *                             *       

G1LMC3_BCL2L2-01       tacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactg
G1LID1_BCL2-02         c-------------------------------------------------
G1LID1_BCL2-01         cccagcatgcagcctctgtttg----acttctcctggctg----------
G1LKR4_BCL2L10-01      ttctgt--------cct------------gcttcacagcg----------
G1L3M8_MCL1-01         ttccatgtagaggacctagaag----gtggcatcagaaat----------
G1L3M8_MCL1-02         ttccatgtagaggacctagaag----gtggcatcagaaat----------

G1LMC3_BCL2L2-01       ggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctgg
G1LID1_BCL2-02         -------------------------------------------gcttgaa
G1LID1_BCL2-01         -------tctctgaaggccctgctcagtctggccctggtgggagcttgca
G1LKR4_BCL2L10-01      -------gtgatcttaatc--------tacttctggaaaagg--------
G1L3M8_MCL1-01         -------gtgctgctggcttttgcaggtgttgctggagtaggagctggtt
G1L3M8_MCL1-02         -------gtgctgctggcttttgcaggtgttgctggagtaggagctggtt

G1LMC3_BCL2L2-01       taactgtaggggccttttttgctagcaagtga
G1LID1_BCL2-02         --------------------------------
G1LID1_BCL2-01         tcaccctgggtgcctacctgggccacaag---
G1LKR4_BCL2L10-01      -----------------ttattgtga------
G1L3M8_MCL1-01         ---------tggcatatctaataagatag---
G1L3M8_MCL1-02         ---------tggcatatctaataaga------

© 1998-2019