Dataset for CDS BCL-2 of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1LID1_BCL2-02      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccac
G1LID1_BCL2-01      ---ccccaccccg------cagcgt--------------------------------ccc
                        * *** * *      *** **                                * *

G1LID1_BCL2-02      tataagctgtcgcagaggggctacgagtgggatgccggagacgcggcccc-cgccgccgc
G1LID1_BCL2-01      cccggcccttcgt-gaggcgctg----------gcaggtggcgccgccaagcgccgccgc
                          *  ***  **** ***           ** ** * *** ***   *********

G1LID1_BCL2-02      cgccgccgcgggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgcca
G1LID1_BCL2-01      cgccgccgcgggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgcca
                    ************************************************************

G1LID1_BCL2-02      ggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagct
G1LID1_BCL2-01      ggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagct
                    ************************************************************

G1LID1_BCL2-02      gcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcag
G1LID1_BCL2-01      gcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcag
                    ************************************************************

G1LID1_BCL2-02      ggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgt
G1LID1_BCL2-01      ggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgt
                    ************************************************************

G1LID1_BCL2-02      ggagagcgtcaaccgggagatgtcgcccctggtggacaacattgccctgtggatgactga
G1LID1_BCL2-01      ggagagcgtcaaccgggagatgtcgcccctggtggacaacattgccctgtggatgactga
                    ************************************************************

G1LID1_BCL2-02      gtacctgaaccggcacctgcacacctggatccaggacaacggaggctgg-----------
G1LID1_BCL2-01      gtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggatgcctttgt
                    *************************************************           

G1LID1_BCL2-02      gtaggtgcacgtcc----------------------------------------------
G1LID1_BCL2-01      ggagttgtacggccccagcatgcagcctctgtttgacttctcctggctgtctctgaaggc
                    * ** ** *** **                                              

G1LID1_BCL2-02      -------------------------gcttgaa----------------------------
G1LID1_BCL2-01      cctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaa
                                             ***** *                            

G1LID1_BCL2-02      -
G1LID1_BCL2-01      g
                     

© 1998-2018