Dataset for CDS MCL-1 of organism Acanthochromis polyacanthus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q1EQB9_MCL1-01      atgaatatgattcctacgaagaggacgacgctgatgaactgcttaatctt
A0A3Q1EQB9_MCL1-02      atgaatatgattcctacgaagaggacgacgctgatgaactgcttaatctt
                        **************************************************

A0A3Q1EQB9_MCL1-01      tccgcaaaatggagtcgtggagggaccgatgcactatggatccggagatt
A0A3Q1EQB9_MCL1-02      tccgcaaaatggagtcgtggagggaccgatgcactatggatccggagatt
                        **************************************************

A0A3Q1EQB9_MCL1-01      cctccccgcagatttccgtggcctcctctatagatcctcaaaacgggaat
A0A3Q1EQB9_MCL1-02      cctccccgcagatttccgtggcctcctctatagatcctcaaaacgggaat
                        **************************************************

A0A3Q1EQB9_MCL1-01      cttggctccagtgataccccaaaacggccgaagaacctgggagtgaacgg
A0A3Q1EQB9_MCL1-02      cttggctccagtgataccccaaaacggccgaagaacctgggagtgaacgg
                        **************************************************

A0A3Q1EQB9_MCL1-01      gtatgcgccaaaaagccttcgacaagacagcgacagtatggaggacggct
A0A3Q1EQB9_MCL1-02      gtatgcgccaaaaagccttcgacaagacagcgacagtatggaggacggct
                        **************************************************

A0A3Q1EQB9_MCL1-01      ctttaccgtgcaccccagagctccagtcggacagtgaaaccgacgtctcc
A0A3Q1EQB9_MCL1-02      ctttaccgtgcaccccagagctccagtcggacagtgaaaccgacgtctcc
                        **************************************************

A0A3Q1EQB9_MCL1-01      agttgtccaacaggggacgagttgctggagaatgacacgaggcaactcat
A0A3Q1EQB9_MCL1-02      agttgtccaacaggggacgagttgctggagaatgacacgaggcaactcat
                        **************************************************

A0A3Q1EQB9_MCL1-01      tcgccgtttcttaagagactttactggactttcaaagccccggtggaatg
A0A3Q1EQB9_MCL1-02      tcgccgtttcttaagagactttactggactttcaaagccccggtggaatg
                        **************************************************

A0A3Q1EQB9_MCL1-01      aaagcaaagcattatcaacaatgaaaagagtggtggatgacgttttggac
A0A3Q1EQB9_MCL1-02      aaagcaaagcattatcaacaatgaaaagagtggtggatgacgttttggac
                        **************************************************

A0A3Q1EQB9_MCL1-01      aaacacagatactcatacaatggtatgatcaacaaactgtcgctggatga
A0A3Q1EQB9_MCL1-02      aaacacagatactcatacaatggtatgatcaacaaactgtcgctggatga
                        **************************************************

A0A3Q1EQB9_MCL1-01      cataggggatgatgtgtcgtttgtcagtgcagtagctaagagcctgtttg
A0A3Q1EQB9_MCL1-02      cataggggatgatgtgtcgtttgtcagtgcagtagctaagagcctgtttg
                        **************************************************

A0A3Q1EQB9_MCL1-01      cagacaggacaaccaactggggtcgtattacgagcctggtggccttcggg
A0A3Q1EQB9_MCL1-02      cagacaggacaaccaactggggtcgtattacgagcctggtggccttcggg
                        **************************************************

A0A3Q1EQB9_MCL1-01      gcggtggtttgtcagtacttaaaggagaggggcagggagaactgcgtgga
A0A3Q1EQB9_MCL1-02      gcggtggtttgtcagtacttaaaggagaggggcagggagaactgcgtgga
                        **************************************************

A0A3Q1EQB9_MCL1-01      cctggtcagccaggagatttccacatacctgctttctgaacagcgagact
A0A3Q1EQB9_MCL1-02      cctggtcagccaggagatttccacatacctgctttctgaacagcgagact
                        **************************************************

A0A3Q1EQB9_MCL1-01      ggctggtcaaaaacaactcatgggacggttttgtggagttttttcgagta
A0A3Q1EQB9_MCL1-02      ggctggtcaaaaacaactcatgggacggttttgtggagttttttcgagta
                        **************************************************

A0A3Q1EQB9_MCL1-01      gcagaccctgagttgacggtcagaaacacactcatggcctttgctggatt
A0A3Q1EQB9_MCL1-02      gcagaccctgagttgacggtcagaaacacactcatggcctttgctggatt
                        **************************************************

A0A3Q1EQB9_MCL1-01      tgctggtattggggcaacactggccctgctgatcag--------------
A0A3Q1EQB9_MCL1-02      tgctggtattggggcaacactggccctgctgatcagactggaaagtaaat
                        ************************************              

A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      ttggggaaacccagaggaccgggagaggagccggaggcaaacgatggatc
                                                                          

A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      caggggggccggaggaaaccacaggagaggaaccggaggagacacgatgc
                                                                          

A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      ctgcagggaccgaggcagggggcaagggaaccgacagaactggagggttc
                                                                          

A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      caaggagggggaaccaggagggacacggagccggcaggggtccaagacgg
                                                                          

A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      aagcaaggagacagactgggcaggagtggtccggacagcgggatcctcca
                                                                          

A0A3Q1EQB9_MCL1-01      ------------------------------------------------gt
A0A3Q1EQB9_MCL1-02      ggagaggagaacagagaaaaagacgttagtctcagaaatacttgtcacgt
                                                                        **

A0A3Q1EQB9_MCL1-01      ga
A0A3Q1EQB9_MCL1-02      aa
                         *

© 1998-2019