Dataset for CDS BOK of Organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287AST0_BOK-01      atggaagtgctgaggcgctcctcggtcttcgccgccgagatcatggacgc
A0A287AST0_BOK-02      atggaagtgctgaggcgctcctcggtcttcgccgccgagatcatggacgc
                       **************************************************

A0A287AST0_BOK-01      ctttgaccgctcgcccaccgacaaggagctggtggcccaggccaaggccc
A0A287AST0_BOK-02      ctttgaccgctcgcccaccgacaaggagctggtggcccaggccaaggccc
                       **************************************************

A0A287AST0_BOK-01      tcggccgggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctgg
A0A287AST0_BOK-02      tcggccgggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctgg
                       **************************************************

A0A287AST0_BOK-01      aacgcgcccgagcgcgccgcgcccgcccccggcggccgtctggccgaggt
A0A287AST0_BOK-02      aacgcgcccgagcgcgccgcgcccgcccccggcggccgtctggccgaggt
                       **************************************************

A0A287AST0_BOK-01      gtgcgcggtgctgctgcgtctggcggacgagctggagctgattcggccca
A0A287AST0_BOK-02      gtgcgcggtgctgctgcgtctggcggacgagctggagctgattcggccca
                       **************************************************

A0A287AST0_BOK-01      gtgtctatcgcaacgtggcccgccagctgaacctctccctgcagtccgag
A0A287AST0_BOK-02      gtgtctatcgcaacgtggcccgccagctgaacctctccctgcagtccgag
                       **************************************************

A0A287AST0_BOK-01      accgtggtgaccgacgccttcctcgccgtggcggcccagatcttctctgc
A0A287AST0_BOK-02      accgtggtgaccgacgccttcctcgccgtggcggcccagatcttctctgc
                       **************************************************

A0A287AST0_BOK-01      aggcatcacgtgggggaaggtggtgtccctctactcagtggctgcggggc
A0A287AST0_BOK-02      aggcatcacgtgggggaaggtggtgtccctctactcagtggctgcggggc
                       **************************************************

A0A287AST0_BOK-01      tggccgtggactgcgtgcggcaggcccagcccgccatggtccatgccctt
A0A287AST0_BOK-02      tggccgtggactgcgtgcggcaggcccagcccgccatggtccatgccctt
                       **************************************************

A0A287AST0_BOK-01      gtcgactgcctcggggagtttgtgcgcaagaccctggcgacctggctgcg
A0A287AST0_BOK-02      gtcgactgcctcggggagtttgtgcgcaagaccctggcgacctggctgcg
                       **************************************************

A0A287AST0_BOK-01      gaggcgcggcggatggacggaccttctcaagtgcgtggtcagtgccgacc
A0A287AST0_BOK-02      gaggcgcggcggatggacggaccttctcaagtgcgtggtcagtgccgacc
                       **************************************************

A0A287AST0_BOK-01      ccggccgccgctcccactggctcgtggccgcgttctgcagcttcggccgc
A0A287AST0_BOK-02      ccggccgccgctcccactggctcgtggccgcgttctgcagcttcggccgc
                       **************************************************

A0A287AST0_BOK-01      ttcctgaaggctgccttcttcctgctgctgccggagagatga
A0A287AST0_BOK-02      ttcctgaaggctgccttcttcctgctgctgccggagagatga
                       ******************************************

© 1998-2018