Dataset for CDS BAX of Organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F1RIQ4_BAX-01      atgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatgggg
F1RIQ4_BAX-02      atgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatgggg
                   ************************************************************

F1RIQ4_BAX-01      ggagagacacctgagctgggcctggagcaggtgcctcaggatgcatctaccaagaagttg
F1RIQ4_BAX-02      ggagagacacctgagctgggcctggagcaggtgcctcaggatgcatctaccaagaagttg
                   ************************************************************

F1RIQ4_BAX-01      agcgagtgtctcaagcgcattggagatgaactggacagtaacatggagctgcagaggatg
F1RIQ4_BAX-02      agcgagtgtctcaagcgcattggagatgaactggacagtaacatggagctgcagaggatg
                   ************************************************************

F1RIQ4_BAX-01      atcgcagccgtggacacggactccccccgagaagtctttttccgagtggcggccgaaatg
F1RIQ4_BAX-02      atcgcagccgtggacacggactccccccgagaagtctttttccgagtggcggccgaaatg
                   ************************************************************

F1RIQ4_BAX-01      tttgctgacggcaacttcaactggggccgggtggtcgcgcttttctactttgccagtaaa
F1RIQ4_BAX-02      tttgctgacggcaacttcaactggggccgggtggtcgcgcttttctactttgccagtaaa
                   ************************************************************

F1RIQ4_BAX-01      ctggtgctcaaggccctgtgcaccagggtgcccgaactgatcaggaccatcatgggctgg
F1RIQ4_BAX-02      ctggtgctcaaggccctgtgcaccagggtgcccgaactgatcaggaccatcatgggctgg
                   ************************************************************

F1RIQ4_BAX-01      acgctggacttccttcgagatcggctgctgggctggatccaggaccagggtggttgggac
F1RIQ4_BAX-02      acgctggacttccttcgagatcggctgctgggctggatccaggaccagggtggttgggac
                   ************************************************************

F1RIQ4_BAX-01      ggcctcctctcctactttgggacgcccacgtggcagacggtgaccatcttcgtggccgga
F1RIQ4_BAX-02      ggcctcctctcctactttgggacgcccacgtggcagacggtgaccatcttcgtggccgga
                   ************************************************************

F1RIQ4_BAX-01      gtgctcaccgcctcgctcaccatctggaagaagatgggctga
F1RIQ4_BAX-02      gtgctcaccgcctcgctcaccatctggaagaagatgggctga
                   ******************************************

© 1998-2018