Dataset for CDS BAX of Organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F1RIQ4_BAX-01      atgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatgggg
F1RIQ4_BAX-02      atgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatgggg

F1RIQ4_BAX-01      ggagagacacctgagctgggcctggagcaggtgcctcaggatgcatctaccaagaagttg
F1RIQ4_BAX-02      ggagagacacctgagctgggcctggagcaggtgcctcaggatgcatctaccaagaagttg

F1RIQ4_BAX-01      agcgagtgtctcaagcgcattggagatgaactggacagtaacatggagctgcagaggatg
F1RIQ4_BAX-02      agcgagtgtctcaagcgcattggagatgaactggacagtaacatggagctgcagaggatg

F1RIQ4_BAX-01      atcgcagccgtggacacggactccccccgagaagtctttttccgagtggcggccgaaatg
F1RIQ4_BAX-02      atcgcagccgtggacacggactccccccgagaagtctttttccgagtggcggccgaaatg

F1RIQ4_BAX-01      tttgctgacggcaacttcaactggggccgggtggtcgcgcttttctactttgccagtaaa
F1RIQ4_BAX-02      tttgctgacggcaacttcaactggggccgggtggtcgcgcttttctactttgccagtaaa

F1RIQ4_BAX-01      ctggtgctcaaggccctgtgcaccagggtgcccgaactgatcaggaccatcatgggctgg
F1RIQ4_BAX-02      ctggtgctcaaggccctgtgcaccagggtgcccgaactgatcaggaccatcatgggctgg

F1RIQ4_BAX-01      acgctggacttccttcgagatcggctgctgggctggatccaggaccagggtggttgggac
F1RIQ4_BAX-02      acgctggacttccttcgagatcggctgctgggctggatccaggaccagggtggttgggac

F1RIQ4_BAX-01      ggcctcctctcctactttgggacgcccacgtggcagacggtgaccatcttcgtggccgga
F1RIQ4_BAX-02      ggcctcctctcctactttgggacgcccacgtggcagacggtgaccatcttcgtggccgga

F1RIQ4_BAX-01      gtgctcaccgcctcgctcaccatctggaagaagatgggctga
F1RIQ4_BAX-02      gtgctcaccgcctcgctcaccatctggaagaagatgggctga

© 1998-2019