Dataset for CDS BAK1 of Organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F1RZR2_BAK1-03      atggcgtccggccaaggcccaggcccccccaggcagggctgtggagagcccgacccctcg
F1RZR2_BAK1-01      atggcgtccggccaaggcccaggcccccccaggcagggctgtggagagcccgacccctcg
F1RZR2_BAK1-02      atggcgtccggccaaggcccaggcccccccaggcagggctgtggagagcccgacccctcg

F1RZR2_BAK1-03      tccacatcagaggagcaggtggcccgggacacggaggaggttttccgcagctacgttttt
F1RZR2_BAK1-01      tccacatcagaggagcaggtggcccgggacacggaggaggttttccgcagctacgttttt
F1RZR2_BAK1-02      tccacatcagaggagcaggtggcccgggacacggaggaggttttccgcagctacgttttt

F1RZR2_BAK1-03      caccgccatcagcaggagcaggaggccgagggggcagctgcgcccaccgacccagagatg
F1RZR2_BAK1-01      caccgccatcagcaggagcaggaggccgagggggcagctgcgcccaccgacccagagatg
F1RZR2_BAK1-02      caccgccatcagcaggagcaggaggccgagggggcagctgcgcccaccgacccagagatg

F1RZR2_BAK1-03      gtcaccctgcccctagaacctagcagcaccatggggcaggtaggccgccagctcgccatc
F1RZR2_BAK1-01      gtcaccctgcccctagaacctagcagcaccatggggcaggtaggccgccagctcgccatc
F1RZR2_BAK1-02      gtcaccctgcccctagaacctagcagcaccatggggcaggtaggccgccagctcgccatc

F1RZR2_BAK1-03      attggggatgacatcaaccggcgatacgactcggaattccaggccatgctgcagcacctg
F1RZR2_BAK1-01      attggggatgacatcaaccggcgatacgactcggaattccaggccatgctgcagcacctg
F1RZR2_BAK1-02      attggggatgacatcaaccggcgatacgactcggaattccaggccatgctgcagcacctg

F1RZR2_BAK1-03      cagccgacagcggaaaacgcctatgagtacttcaccaagatcgcctccagcctgttcgag
F1RZR2_BAK1-01      cagccgacagcggaaaacgcctatgagtacttcaccaagatcgcctccagcctgttcgag
F1RZR2_BAK1-02      cagccgacagcggaaaacgcctatgagtacttcaccaagatcgcctccagcctgttcgag

F1RZR2_BAK1-03      agtggcatcaactggggccgagtggtggctcttctgggctttggctaccgcctggccctg
F1RZR2_BAK1-01      agtggcatcaactggggccgagtggtggctcttctgggctttggctaccgcctggccctg
F1RZR2_BAK1-02      agtggcatcaactggggccgagtggtggctcttctgggctttggctaccgcctggccctg

F1RZR2_BAK1-03      tacgtctaccagaggggcctgaccggcttcctaggccaggtgacccgctttgtggccgac
F1RZR2_BAK1-01      tacgtctaccagaggggcctgaccggcttcctaggccaggtgacccgctttgtggccgac
F1RZR2_BAK1-02      tacgtctaccagaggggcctgaccggcttcctaggccaggtgacccgctttgtggccgac

F1RZR2_BAK1-03      ttcatgctgcatcactgcatcgcccggtggattgcgcagaggggtggctgggtggcagcc
F1RZR2_BAK1-01      ttcatgctgcatcactgcatcgcccggtggattgcgcagaggggtggctgggtggcagcc
F1RZR2_BAK1-02      ttcatgctgcatcactgcatcgcccggtggattgcgcagaggggtggctgggtggcagcc

F1RZR2_BAK1-03      ctggatttgggaaacggccccatccggaacgtgctgctagttctggctgtggttttgctg
F1RZR2_BAK1-01      ctggatttgggaaacggccccatccggaacgtgctgctagttctggctgtggttttgctg
F1RZR2_BAK1-02      ctggatttgggaaacggccccatccggaacgtgctgctagttctggctgtggttttgctg

F1RZR2_BAK1-03      ggccagtttgtggtacgcagattcttcaggtcatga
F1RZR2_BAK1-01      ggccagtttgtggtacgcagattcttcaggtcatga
F1RZR2_BAK1-02      ggccagtttgtggtacgcagattcttcaggtcatga

© 1998-2019