Dataset for CDS BAX-like of Organism Strongylocentrotus purpuratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W4Y4K1_BAX-01       atgtactgcaacagaaa---ttgtgactcatca-acg--acaagtttgcatt--------
W4YE49_BAK1-01      atg----gcaacgggtacctctacgattacccagacggtgcaggaggacacggaggagaa
                    ***    ***** *  *    *  ** *   ** ***   ** *    **          

W4Y4K1_BAX-01       -----ttgagcagaca--------cgtatccaacttgaacgccaagtgagccgtgat-ga
W4YE49_BAK1-01      cgtgattgaacagacggagatgatcgtcagaaacttcttccaccagaggctggcgatgga
                         **** *****         ***    *****   *  * ** *    * *** **

W4Y4K1_BAX-01       cgttggggagcaagcgactgttctccttcagcatttcatcgtagaacgattccag-----
W4YE49_BAK1-01      catgcaggatcagacgaatgata----ttaatatatcaacgcctag-gataccagagtta
                    * *   *** **  *** ** *     * *  ** *** **   *  *** ****     

W4Y4K1_BAX-01       caggatggttttgccgatgctccggggctg--gatgacctgagggcgg-ggctcgctgtg
W4YE49_BAK1-01      cagaatttcactgcagaccctttaagtccgacgtcgagagtagggaggagactagctcag
                    *** **     *** **  **    * * *  *  **    **** ** * ** ***  *

W4Y4K1_BAX-01       ccgagtgagcaagaggttgtctggtcagaggtcggggtcatgttgaggtcaatcggagac
W4YE49_BAK1-01      attggagaccaaatagatgcacagtacgagggagagttc---------------------
                        * ** ***   * **    **  ****  * * **                     

W4Y4K1_BAX-01       acgttagacagggatcgaga-gctgcagaggatgataagctctgttccagtcgactcacc
W4YE49_BAK1-01      -cgtcagat---gatccagatgctaca------cataaccccc-------tcaac-cgcc
                     *** ***    **** *** *** **       **** * *        ** ** * **

W4Y4K1_BAX-01       catcgag-----gccatcatagcagtggcacatgtcatctttggagatggtgatatcaca
W4YE49_BAK1-01      tatcaagcattcgccggtgtagcaa----gaagattatttatcaag-----ggcatcaac
                     *** **     ***    *****       *  * ** * *  **     *  ****  

W4Y4K1_BAX-01       tggggtagaatagtaggtctcttctactttgcttacaggatgtgtgctagggcaatagaa
W4YE49_BAK1-01      tgggggcgtatttcggcgcttctcatgttcggttaccgtat---cgctagagacgtgatg
                    *****  * **    *  **  **   ** * **** * **    ***** *   *    

W4Y4K1_BAX-01       acaattatggataagagttttcctagctggatcaacaagctgatcaaggaagtcgtcaag
W4YE49_BAK1-01      acgagtgtgg----gggatttct--------ttcacaagattgtcggcgatctggt---g
                    ** * * ***    * * ****         *  ***** *  **   **  * **   *

W4Y4K1_BAX-01       ttccttgttatc------aaattcgcccactggattgt-taacaagggtggatggctggc
W4YE49_BAK1-01      cgtttcatcatctcagagagaatcgcaacatggatagcacaacaagga-----ggctgga
                        *  * ***      * * ****    ***** *   *******      ****** 

W4Y4K1_BAX-01       catc--cgtgaatatatgggctcaccgacctggatatgggggaccctcatgacactc---
W4YE49_BAK1-01      tttcagcgctgaacttcagaatagagaaccccggtgtagg----cttcattgcaatagca
                      **  **   *  *   *  *     ***  * * * **    * ****  ** *    

W4Y4K1_BAX-01       --tctgctagctgt----ctcatcttctccttctacaagctaag---tagatga
W4YE49_BAK1-01      ggtctgtcagcgttagccatcgtgtgtgcagtcgtatggtcaagatctagatag
                      ****  ***  *     ** * *   *  **     *  ***   *****  

© 1998-2018