Dataset for CDS BAX-like of Organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3VAK3_BOK-01       atggaggtcctgcggcgctcgtcagtgttcgcggcggaggggatggaggtgttcga--cc
G3VRP5_BAK1-01      atggc----------------------ttctaggcaggtgagccgg----gttcgagccc
                    ****                       ***  *** *  * *  **    ******  **

G3VAK3_BOK-01       gctcccccaccgacaaggcgctggtgtcc---caggccaaagcgctgtgtcgggaataca
G3VRP5_BAK1-01      cttcatctactgcagaggaacaggtggctctacagactgaagaggttttccgaagctatg
                      **  * ** *   ***  * **** *    *** *  *** * * *  **    **  

G3VAK3_BOK-01       tc--cagtcgcggctctcccgggccggcctgggctgga------------gcaagcccga
G3VRP5_BAK1-01      tcttctatcgccatcaacaagagcaggaaagtgagggagatgctgtccttgcagacccag
                    **  *  ****      *  * ** **   * *  ***            ***  ***  

G3VAK3_BOK-01       g--------------tacaag---------------gcgccgacgcc------cgggggg
G3VRP5_BAK1-01      aaatggacaccctgccacaagagctcagcagttactgccccagcaccacagaacaggtgg
                                    *****               ** **  * **      * ** **

G3VAK3_BOK-01       a-----agctggcc------gagatttccagcatcctcctgcgt---------ctggggg
G3VRP5_BAK1-01      gccgacagctggccatcattggggataacatcattcgcaggtataactcagaatttgagg
                          ********      * *  *  ** *** * *  *  *          * * **

G3VAK3_BOK-01       atgagctggagtacatccggcccaacgtgtaccggaacatcgcccggcagctcaacatct
G3VRP5_BAK1-01      ccatgctgcagcatttgcagcccacc-----ccggaa-actgcc----------------
                        **** ** *  * * ***** *     ****** *  ***                

G3VAK3_BOK-01       ccctgcagtcggagagcgtggtgaccgacgccttcctggccgtggccactcagatcttcg
G3VRP5_BAK1-01      --------tatgagagcttcgtcaagatcgcctcc--------agcc-------tatttg
                            *  ****** * ** *    ***** *         ***       * ** *

G3VAK3_BOK-01       cggcagggataacgtggggcaaggtggtctccctg-tacgccgtggcagcggggctggc-
G3VRP5_BAK1-01      aaagcggcatcaactggggccgagtggtggcactgctgggctttggctac-cggctggca
                         ** ** *  ******   *****  * *** *  **  ****  *  ******* 

G3VAK3_BOK-01       ---------cgtggactgcgtgcggcaggcgcagccggcca--tggtccacaccatcgtg
G3VRP5_BAK1-01      ctatatgtttatcggaggggtctgactggcttcctgggccatgtggctcgcttcgtggct
                               * *   * **  * * ***      *****  ***  * *  * * *  

G3VAK3_BOK-01       gactgtctg---ggagagtttgtgcggaagacgctggtgacgtggctcaagcggcgcgga
G3VRP5_BAK1-01      gacttcatgctccaacactttgt----cacccgctgg----attgccca----gaacggg
                    ****   **     * * *****     *  ******     * ** **    *  *** 

G3VAK3_BOK-01       ggctgggcag---------------------acatcatgaagtgcgtggtgaacaccgac
G3VRP5_BAK1-01      ggctgggtggcagccctggacctctccaacaactccatttggtacgtgatga--------
                    *******  *                     **  ***   ** **** ***        

G3VAK3_BOK-01       cccagcctccggtctcactggctcgtggccgccctctgcagcttcgggcacttcctgaag
G3VRP5_BAK1-01      --caatcttggggatggt--gctcttgg---------gtcgatt----cattatccgaag
                      **  **  **  *     **** ***         *  * **    ** *  * ****

G3VAK3_BOK-01       gccatcttcttcgtcctgctccccgagagatga
G3VRP5_BAK1-01      a--------ttctttcaaccc---------tga
                             *** * *  * *         ***

© 1998-2019