Dataset for CDS BAX of Organism Salmo salar

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

B5XC79_BAX-01      atggcagactcccgagaaagaaggaaaaccggcgaagatgagcctcagggtgcagtcggg
B5X9C5_BAX-01      atggcagactcccgagaaagaaggaaaactggcgaagatgagcctcagggtgcattcggg
B5X0Y9_BAX-01      atggcagactcccgagaaagaaggaaaactggcgaagatgagcctcagggtgcattcggg
E0R7W0_BAX-01      atggcagactcccgagaaagaaggaaaactggcgaagatgagcctcagggtgcattcggg
                   ***************************** ************************ *****

B5XC79_BAX-01      ggtgaagatgtcatcgacgacagaattatggaacaaggagctgttgttttaagagggtat
B5X9C5_BAX-01      ggtgaagatgtcaacgacgacagaattatggaacaaggagctattgttttaagagggtat
B5X0Y9_BAX-01      ggtgaagatgtcaacgacgacagaattatggaacaaggagctattgttttaagagggtat
E0R7W0_BAX-01      ggtgaagatgtcaacgacgacagaattatggaacaaggagctattgttttaagagggtat
                   ************* **************************** *****************

B5XC79_BAX-01      gtcatcgagagggtcagtgcagaaaacccagagaggcgtttggctccagaggaccttggt
B5X9C5_BAX-01      gtcatagagaggatcagtgcagaaaacccagcgaggcatttggctccagaggaccttggt
B5X0Y9_BAX-01      gtcatagagaggatcagtgcagaaaacccagcgaggcatttggctccagaggaccttggt
E0R7W0_BAX-01      gtcatagagaggatcagtgcagaaaacccagcgaggcatttggctccagaggaccttggt
                   ***** ****** ****************** ***** **********************

B5XC79_BAX-01      ggcagacccaacgaacaagaggaccaccaagtcaaagacgtggtacaccagctgctgctg
B5X9C5_BAX-01      ggcagacccaacgaacaagaggaccaccaagtcaaagacgtggtacaccagctgctgctg
B5X0Y9_BAX-01      ggcagacccaacgaacaagaggaccaccaagtcaaagacgtggtacaccagctgctgctg
E0R7W0_BAX-01      ggcagacccaacgaacaagaggaccaccaagtcaaagacgtggtacaccagctgctgctg

B5XC79_BAX-01      atcgctgatgacctgaacagaaatgctgagctacaacacctaataagcacagtccaggtg
B5X9C5_BAX-01      atcgctgatgacatgaacagaaatgctgagctacaacacctaataagcagagtccaggta
B5X0Y9_BAX-01      atcgctgatgacctgaacagaaatgctgagctacaacacctaataagcagagtccaggta
E0R7W0_BAX-01      atcgctgatgacctgaacagaaatgctgagctacaacacctaataagcagagtccaggta
                   ************ ************************************ ********* 

B5XC79_BAX-01      aactgtgcccaggatgtgttcttctcagtggccagggaaatctttgcagatggtatcaac
B5X9C5_BAX-01      aactgtgcccaggatgtgttcttctcagtggccaaggaaatctttgcagatggtatcaac
B5X0Y9_BAX-01      aactgtgcccaggatgtgttcttctcagtggccagggaaatctttgcagatggtatcaac
E0R7W0_BAX-01      aactgtgcccaggatgtgttcttctcagtggccagggaaatctttgcagatggtatcaac
                   ********************************** *************************

B5XC79_BAX-01      tggggcagagtggtcacactgtttcacttggcctacaagcttatttacaaggcactgaca
B5X9C5_BAX-01      tggggcagagtggtctccctgtttcacttggcctacaagcttatttacaaggcactgaca
B5X0Y9_BAX-01      tggggcagagtggtctccctgtttcacttggcctacaagcttatttacaaggcactgaca
E0R7W0_BAX-01      tggggcagagtggtctccctgtttcacttggcctacaagcttatttacaaggcactgaca
                   *************** * ******************************************

B5XC79_BAX-01      cagaaccacttagaaatcatcaagaaggttattagctgggtattacagttcatcagggaa
B5X9C5_BAX-01      cagaaccacttagaaatcatcaagaaggttattagctgggtattacagttcatcagggaa
B5X0Y9_BAX-01      cagaaccacttagaaatcatcaagaaggttattagctgggtattacagttcatcagggaa
E0R7W0_BAX-01      cagaaccacttagaaatcatcaagaaggttattagctgggtattacagttcatcagggaa

B5XC79_BAX-01      aatgtctccgcttggatccgacagcaaggaggatgggaggcggctgttagcaccgtgtca
B5X9C5_BAX-01      aatgtctccgcttggatccgacagcaaggaggatgggaggcggttgttagcactgtgtca
B5X0Y9_BAX-01      aatgtctccgcttggatccgacagcaaggaggatgggaggcggttgttagcactgtgtca
E0R7W0_BAX-01      aatgtctccgcttggatccgacagcaaggaggatgggaggcggttgttagcactgtgtca
                   ******************************************* ********* ******

B5XC79_BAX-01      cattggcgtactgtgtcacttgtggctgcagtggctttcgtgacggccatggtttactgg
B5X9C5_BAX-01      cattggcgtacggtgtcgcttgtggctgcagtggctttcgtggcggtcatggtttactgg
B5X0Y9_BAX-01      cattggcgtacggtgtcgcttgtggctgcagtggctttcgtggcggtcatggtttactgg
E0R7W0_BAX-01      cattggcgtacggtgtcgcttgtggctgcagtggctttcgtggcggtcatggtttactgg
                   *********** ***** ************************ *** *************

B5XC79_BAX-01      aggaaaacacgctga
B5X9C5_BAX-01      aggaaaacacgctga
B5X0Y9_BAX-01      aggaaaatacgctga
E0R7W0_BAX-01      aggaaaacacgctga
                   ******* *******

© 1998-2018