Dataset for CDS BAX-like of Organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6T885_BOK-01      atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgc
A0A2K6UFS4_BAX-04      ---------------------cccaccagctctgagcagatcatgaa---
A0A2K6UFS4_BAX-05      ---------------------cccaccagctctgagcagatcatgaa---
                                             **  *  * * *   ******** *   

A0A2K6T885_BOK-01      ctttgaccgctcgcccacggacaaggagctggtggcccaggccaaagcgc
A0A2K6UFS4_BAX-04      -------------------gacaggggcccttttgct-------------
A0A2K6UFS4_BAX-05      -------------------gacaggggcccttttgct-------------
                                          **** **  *   * **              

A0A2K6T885_BOK-01      tgggccgggaatacgtgcacgcgcggctgctgcgcgccggcctctcctgg
A0A2K6UFS4_BAX-04      ----tcagggtttcatccaggatcgagcagggcgaatcgg------aggg
A0A2K6UFS4_BAX-05      ----tcagg-----------------------------------------
                            * **                                         

A0A2K6T885_BOK-01      agcgcgcccgagcgcgccgcgccagtcccggggcgcctggccg-------
A0A2K6UFS4_BAX-04      gaggcacccgagctggcc---ctggacccggtgccccaggatgcgtccac
A0A2K6UFS4_BAX-05      --------------------------------------------------
                                                                         

A0A2K6T885_BOK-01      -----aggtgtgcgccgtgctgctgcgcctgggtgatgagctgg------
A0A2K6UFS4_BAX-04      caagaagctgagcgagtgtctcaagcgcatcggagacgaactggacagta
A0A2K6UFS4_BAX-05      --------------------------------------------------
                                                                         

A0A2K6T885_BOK-01      ---------------agatgatccggcccagcgtctaccgcaacgtggca
A0A2K6UFS4_BAX-04      acatggagctgcagaggatgat----------------cgccactgtgga
A0A2K6UFS4_BAX-05      ---------------ggatgat----------------cgccactgtgga
                                       ******                *** **   * *

A0A2K6T885_BOK-01      cgccagctgcacatccccctgcagtctgagccc--gtggtgactgacgcg
A0A2K6UFS4_BAX-04      cacaaactcc----ccccgagaggtctttttccgagtggcggctgacatg
A0A2K6UFS4_BAX-05      cacaaactcc----ccccgagaggtctttttccgagtggcggctgacatg
                       * * * ** *    ****  *  ****    **  **** * *****  *

A0A2K6T885_BOK-01      ttcct-------------------ggccgtggctggccacatcttctccg
A0A2K6UFS4_BAX-04      ttctctgatggcaacttcaactggggccg-ggttgtcgcctttttctact
A0A2K6UFS4_BAX-05      ttctctgatggcaacttcaactggggccg-ggttgtcgcctttttctact
                       ***                     ***** ** ** *  * * **** * 

A0A2K6T885_BOK-01      caggcatcacgtggggcaaggtggtgt------ccctgtatgcggtggcg
A0A2K6UFS4_BAX-04      ttgcca---------gcaaactggtgctcaaggccctgtgtgccaaggtg
A0A2K6UFS4_BAX-05      ttgcca---------gcaaactggtgctcaaggccctgtgtgccaaggtg
                         * **         ****  *****       ****** ***   ** *

A0A2K6T885_BOK-01      gcagggct----------------ggctgtgact---gatgtcctcaag-
A0A2K6UFS4_BAX-04      cccgagctgatcagaaccatcatgggctg-gactttggacttcctccggg
A0A2K6UFS4_BAX-05      cccgagctgatcagaaccatcatgggctg-gactttggacttcctccggg
                        * * ***                ***** ****   **  *****  * 

A0A2K6T885_BOK-01      ------tgtgtggtcag--cacagacc------------ctggcctccgc
A0A2K6UFS4_BAX-04      agcggctgttgggctggatccaagaccagggtggttgggatagcctcctc
A0A2K6UFS4_BAX-05      agcggctgttgggctggatccaagaccagggtggttgggatagcctcctc
                             ***  **   *  *  *****             * ****** *

A0A2K6T885_BOK-01      tcccact---ggctgctcgccgcgctctgcagcttcggccgcttc-----
A0A2K6UFS4_BAX-04      tcctactttgggacaccca-cgtggcagacag---tgaccatctttgtgg
A0A2K6UFS4_BAX-05      tcctactttgggacaccca-cgtggcagacag---tgaccatctttgtgg
                       *** ***   **   * *  ** *     ***    * **   *      

A0A2K6T885_BOK-01      ctgaag-gctgccttcttcgtgctcctgccaga-------gagatga
A0A2K6UFS4_BAX-04      ctggagtgctcaccgcctcacttaccatctggaagaacatgggctga
A0A2K6UFS4_BAX-05      ctggagtgctcaccgcctcacttaccatctggaagaacatgggctga
                       *** ** ***  *  * **     **  *  **       * * ***

© 1998-2018