Dataset for CDS BAX of Organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6UFS4_BAX-04      cccaccagctctgagcagatcatgaagacaggggcccttttgcttcaggg
A0A2K6UFS4_BAX-05      cccaccagctctgagcagatcatgaagacaggggcccttttgcttcagg-

A0A2K6UFS4_BAX-04      tttcatccaggatcgagcagggcgaatcggaggggaggcacccgagctgg
A0A2K6UFS4_BAX-05      --------------------------------------------------

A0A2K6UFS4_BAX-04      ccctggacccggtgccccaggatgcgtccaccaagaagctgagcgagtgt
A0A2K6UFS4_BAX-05      --------------------------------------------------

A0A2K6UFS4_BAX-04      ctcaagcgcatcggagacgaactggacagtaacatggagctgcagaggat
A0A2K6UFS4_BAX-05      ----------------------------------------------ggat

A0A2K6UFS4_BAX-04      gatcgccactgtggacacaaactccccccgagaggtctttttccgagtgg
A0A2K6UFS4_BAX-05      gatcgccactgtggacacaaactccccccgagaggtctttttccgagtgg

A0A2K6UFS4_BAX-04      cggctgacatgttctctgatggcaacttcaactggggccgggttgtcgcc
A0A2K6UFS4_BAX-05      cggctgacatgttctctgatggcaacttcaactggggccgggttgtcgcc

A0A2K6UFS4_BAX-04      tttttctactttgccagcaaactggtgctcaaggccctgtgtgccaaggt
A0A2K6UFS4_BAX-05      tttttctactttgccagcaaactggtgctcaaggccctgtgtgccaaggt

A0A2K6UFS4_BAX-04      gcccgagctgatcagaaccatcatgggctggactttggacttcctccggg
A0A2K6UFS4_BAX-05      gcccgagctgatcagaaccatcatgggctggactttggacttcctccggg

A0A2K6UFS4_BAX-04      agcggctgttgggctggatccaagaccagggtggttgggatagcctcctc
A0A2K6UFS4_BAX-05      agcggctgttgggctggatccaagaccagggtggttgggatagcctcctc

A0A2K6UFS4_BAX-04      tcctactttgggacacccacgtggcagacagtgaccatctttgtggctgg
A0A2K6UFS4_BAX-05      tcctactttgggacacccacgtggcagacagtgaccatctttgtggctgg

A0A2K6UFS4_BAX-04      agtgctcaccgcctcacttaccatctggaagaacatgggctga
A0A2K6UFS4_BAX-05      agtgctcaccgcctcacttaccatctggaagaacatgggctga

© 1998-2019