Dataset for CDS BAX of Organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6UFS4_BAX-04      cccaccagctctgagcagatcatgaagacaggggcccttttgcttcaggg
A0A2K6UFS4_BAX-05      cccaccagctctgagcagatcatgaagacaggggcccttttgcttcagg-
                       ************************************************* 

A0A2K6UFS4_BAX-04      tttcatccaggatcgagcagggcgaatcggaggggaggcacccgagctgg
A0A2K6UFS4_BAX-05      --------------------------------------------------
                                                                         

A0A2K6UFS4_BAX-04      ccctggacccggtgccccaggatgcgtccaccaagaagctgagcgagtgt
A0A2K6UFS4_BAX-05      --------------------------------------------------
                                                                         

A0A2K6UFS4_BAX-04      ctcaagcgcatcggagacgaactggacagtaacatggagctgcagaggat
A0A2K6UFS4_BAX-05      ----------------------------------------------ggat
                                                                     ****

A0A2K6UFS4_BAX-04      gatcgccactgtggacacaaactccccccgagaggtctttttccgagtgg
A0A2K6UFS4_BAX-05      gatcgccactgtggacacaaactccccccgagaggtctttttccgagtgg
                       **************************************************

A0A2K6UFS4_BAX-04      cggctgacatgttctctgatggcaacttcaactggggccgggttgtcgcc
A0A2K6UFS4_BAX-05      cggctgacatgttctctgatggcaacttcaactggggccgggttgtcgcc
                       **************************************************

A0A2K6UFS4_BAX-04      tttttctactttgccagcaaactggtgctcaaggccctgtgtgccaaggt
A0A2K6UFS4_BAX-05      tttttctactttgccagcaaactggtgctcaaggccctgtgtgccaaggt
                       **************************************************

A0A2K6UFS4_BAX-04      gcccgagctgatcagaaccatcatgggctggactttggacttcctccggg
A0A2K6UFS4_BAX-05      gcccgagctgatcagaaccatcatgggctggactttggacttcctccggg
                       **************************************************

A0A2K6UFS4_BAX-04      agcggctgttgggctggatccaagaccagggtggttgggatagcctcctc
A0A2K6UFS4_BAX-05      agcggctgttgggctggatccaagaccagggtggttgggatagcctcctc
                       **************************************************

A0A2K6UFS4_BAX-04      tcctactttgggacacccacgtggcagacagtgaccatctttgtggctgg
A0A2K6UFS4_BAX-05      tcctactttgggacacccacgtggcagacagtgaccatctttgtggctgg
                       **************************************************

A0A2K6UFS4_BAX-04      agtgctcaccgcctcacttaccatctggaagaacatgggctga
A0A2K6UFS4_BAX-05      agtgctcaccgcctcacttaccatctggaagaacatgggctga
                       *******************************************

© 1998-2018