Dataset for CDS BAX-like of Organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6NSH2_BAX-05       atggacgggtccggggag----------------cagcccagaggcgggg
A0A2K6NSH2_BAX-04       atggacgggtccggggag----------------cagcccagaggcgggg
A0A2K6NSH2_BAX-03       atggacgggtccggggag----------------cagcccagaggcgggg
A0A2K6NSH2_BAX-02       atggacgggtccggggag----------------cagcccagaggcgggg
A0A2K6NSH2_BAX-01       --------------------------------------------------
A0A2K6Q8Q6_BOK-01       atggaggtgctgcggcgc---tcctcggtcttcgccgccgagatcatgga
A0A2K6N8C5_BAK1-02      atgg-----cttcgggacaaggcccaggtcctcccaggcaggaatgcgga
A0A2K6N8C5_BAK1-03      atgg-----cttcgggacaaggcccaggtcctcccaggcaggaatgcgga
A0A2K6N8C5_BAK1-01      atgg-----cttcgggacaaggcccaggtcctcccaggcaggaatgcgga

A0A2K6NSH2_BAX-05       ggccca---ccagctctgagcagatcatgaa-------------------
A0A2K6NSH2_BAX-04       gagcgacaccccgttctga-------------------------------
A0A2K6NSH2_BAX-03       ggccca---ccagctctgagcagatcatgaa-------------------
A0A2K6NSH2_BAX-02       ggccca---ccagctctgagcagatcatgaa-------------------
A0A2K6NSH2_BAX-01       --------------------------atgaa-------------------
A0A2K6Q8Q6_BOK-01       tgcctttgaccgctcgcccaccgacaaggagctggtggcccaggccaagg
A0A2K6N8C5_BAK1-02      -gagcctgccctgccttctgcttctgaggagcaggtagcccgggacac--
A0A2K6N8C5_BAK1-03      -gagcctgccctgccttctgcttctgaggagcaggtagcccgggacac--
A0A2K6N8C5_BAK1-01      -gagcctgccctgccttctgcttctgaggagcaggtagcccgggacac--

A0A2K6NSH2_BAX-05       ----------gacaggggcccttttgcttcagggtttcatccaggatcga
A0A2K6NSH2_BAX-04       ---------------------ttctgcaccctcactccatccccactcta
A0A2K6NSH2_BAX-03       ----------gacaggggcccttttgcttcagg-----------------
A0A2K6NSH2_BAX-02       ----------gacaggggcccttttgcttcagggtttcatccaggatcga
A0A2K6NSH2_BAX-01       ----------gacaggggcccttttgcttcagggtttcatccaggatcga
A0A2K6Q8Q6_BOK-01       cgctgggccgggagtacgtgcacgcgcggctac--tgcgcgccggcctct
A0A2K6N8C5_BAK1-02      ----------agaggaggttttc-cgcagctacgttttttaccgccatca
A0A2K6N8C5_BAK1-03      ----------agaggaggttttc-cgcagctacgttttttaccgccatca
A0A2K6N8C5_BAK1-01      ----------agaggaggttttc-cgcagctacgttttttaccgccatca
                                                 **  *                    

A0A2K6NSH2_BAX-05       gcagg-----gcgaatggggggggagacacccgagct--ggccctggacc
A0A2K6NSH2_BAX-04       ----g-----gcgaatggggggggagacacccgagct--ggccctggacc
A0A2K6NSH2_BAX-03       --------------------------------------------------
A0A2K6NSH2_BAX-02       gcagg-----gcgaatggggggggagacacccgagct--ggccctggacc
A0A2K6NSH2_BAX-01       gcagg-----gcgaatggggggggagacacccgagct--ggccctggacc
A0A2K6Q8Q6_BOK-01       cctggagc--gcgcccgagcgcgccgc-gccggtcccgggacgcctggcc
A0A2K6N8C5_BAK1-02      gcagaacc---------------------cctctgccatgag-----cca
A0A2K6N8C5_BAK1-03      gcaggaacaggaggctgaaggggcggctgcccctgcc--gac-----cca
A0A2K6N8C5_BAK1-01      gcaggaacaggaggctgaaggggcggctgcccctgcc--gac-----cca

A0A2K6NSH2_BAX-05       cagtgcctcaggatgcgtccac-------------caagaggctgagcga
A0A2K6NSH2_BAX-04       cagtgcctcaggatgcgtccac-------------caagaggctgagcga
A0A2K6NSH2_BAX-03       --------------------------------------------------
A0A2K6NSH2_BAX-02       cagtgcctcaggatgcgtccac-------------caagaggctgagcga
A0A2K6NSH2_BAX-01       cagtgcctcaggatgcgtccac-------------caagaggctgagcga
A0A2K6Q8Q6_BOK-01       gaggtgtgcgcggtgctcctgc------------------gcctgg-ggg
A0A2K6N8C5_BAK1-02      --------------------------------------aggcctggtggg
A0A2K6N8C5_BAK1-03      gagatggtcaccttgcccctgcaacctagcagcaccatgggacaggtggg
A0A2K6N8C5_BAK1-01      gagatggtcaccttgcccctgcaacctagcagcaccatgggacaggtggg

A0A2K6NSH2_BAX-05       gtg---tctcaagcgcatcggggacgaactggacag-taacatgg-----
A0A2K6NSH2_BAX-04       gtg---tctcaagcgcatcggggacgaactggacag-taacatgg-----
A0A2K6NSH2_BAX-03       --------------------------------------------------
A0A2K6NSH2_BAX-02       gtg---tctcaagcgcatcggggacgaactggacag-taacatgg-----
A0A2K6NSH2_BAX-01       gtg---tctcaagcgcatcggggacgaactggacag-taacatgg-----
A0A2K6Q8Q6_BOK-01       atg--agctggagatgatccggcccagcgtctaccg-caacgtggctcgt
A0A2K6N8C5_BAK1-02      acggcagctcgccatcatcggggacgacatcaaccgacgctatgactcag
A0A2K6N8C5_BAK1-03      acggcagctcgccatcatcggggacgacatcaaccgacgctatgactcag
A0A2K6N8C5_BAK1-01      acggcagctcgccatcatcggggacgacatcaaccgacgctatgactcag

A0A2K6NSH2_BAX-05       -agctgcagaggatgat--------tgccgccgtggacacagactccccc
A0A2K6NSH2_BAX-04       -agctgcagaggatgat--------tgccgccgtggacacagactccccc
A0A2K6NSH2_BAX-03       ----------ggatgat--------tgccgccgtggacacagactccccc
A0A2K6NSH2_BAX-02       -agctgcagaggatgat--------tgccgccgtggacacagactccccc
A0A2K6NSH2_BAX-01       -agctgcagaggatgat--------tgccgccgtggacacagactccccc
A0A2K6Q8Q6_BOK-01       cagctgcacatctccctgcag--tctg-agcctgtggtg------accga
A0A2K6N8C5_BAK1-02      -agttccagaccatgctgcagcacctgcagcccacggcagagaacgccta
A0A2K6N8C5_BAK1-03      -agttccagaccatgctgcagcacctgcagcccacggcagagaacgccta
A0A2K6N8C5_BAK1-01      -agttccagaccatgctgcagcacctgcagcccacggcagagaacgccta
                                        *        **  ***   *          **  

A0A2K6NSH2_BAX-05       cgagaggtctttttccgagtggcagctga--------------------c
A0A2K6NSH2_BAX-04       cgagaggtctttttccgagtggcagctga--------------------c
A0A2K6NSH2_BAX-03       cgagaggtctttttccgagtggcagctga--------------------c
A0A2K6NSH2_BAX-02       cgagaggtctttttccgagtggcagctga--------------------c
A0A2K6NSH2_BAX-01       cgagaggtctttttccgagtggcagctga--------------------c
A0A2K6Q8Q6_BOK-01       tgcg-----ttcctggccgtggctggcca--------------------c
A0A2K6N8C5_BAK1-02      tgag-----tacttcaccaagattgcctc--------------------c
A0A2K6N8C5_BAK1-03      tgag-----tacttcaccaagattgcctccaggccagcaacaacacccac
A0A2K6N8C5_BAK1-01      tgag-----tacttcaccaagattgcctc--------------------c
                         * *     *   *      *   *                        *

A0A2K6NSH2_BAX-05       atgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
A0A2K6NSH2_BAX-04       atgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
A0A2K6NSH2_BAX-03       atgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
A0A2K6NSH2_BAX-02       atgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
A0A2K6NSH2_BAX-01       atgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
A0A2K6Q8Q6_BOK-01       atcttctctgca---ggcatcacgtggggcaaggtggtgtc-cttgtatg
A0A2K6N8C5_BAK1-02      agcctgtttgagagtggcatcaactggggccgtgtggtggctcttctggg
A0A2K6N8C5_BAK1-03      agcctgtttgagagtggcatcaactggggccgtgtggtggctcttctggg
A0A2K6N8C5_BAK1-01      agcctgtttgagagtggcatcaactggggccgtgtggtggctcttctggg
                        *   * * **       * ***  ******   ** **  * *** *   

A0A2K6NSH2_BAX-05       ctttgccagca-aactggtgctcaa------------ggccctgtgtacc
A0A2K6NSH2_BAX-04       ctttgccagca-aactggtgctcaa------------ggccctgtgtacc
A0A2K6NSH2_BAX-03       ctttgccagca-aactggtgctcaa------------ggccctgtgtacc
A0A2K6NSH2_BAX-02       ctttgccagca-aactggtgctcaa------------ggccctgtgtacc
A0A2K6NSH2_BAX-01       ctttgccagca-aactggtgctcaa------------ggccctgtgtacc
A0A2K6Q8Q6_BOK-01       cggtggccgcagggctggccgtggactgtgtgaggcaggcccagcctgcc
A0A2K6N8C5_BAK1-02      cttcggctacc-gtctggccctacac-----------------gtctacc
A0A2K6N8C5_BAK1-03      cttcggctacc-gtctggccctacac-----------------gtctacc
A0A2K6N8C5_BAK1-01      cttcggctacc-gtctggccctacac-----------------gtctacc
                        *   * *  *    ****   *  *                  *  * **

A0A2K6NSH2_BAX-05       aaggtgcccgaactgatcagaacc---------atcatgggctggacact
A0A2K6NSH2_BAX-04       aaggtgcccgaactgatcagaacc---------atcatgggctggacact
A0A2K6NSH2_BAX-03       aaggtgcccgaactgatcagaacc---------atcatgggctggacact
A0A2K6NSH2_BAX-02       aaggtgcccgaactgatcagaacc---------atcatgggctggacact
A0A2K6NSH2_BAX-01       aaggtgcccgaactgatcagaacc---------atcatgggctggacact
A0A2K6Q8Q6_BOK-01       atggtccacgccctcgtggactgcctgggggagtttgtgcgcaagaccct
A0A2K6N8C5_BAK1-02      ag----cgcggcctgactggcttcctgggccaggtgacccgcttcgtggt
A0A2K6N8C5_BAK1-03      ag----cgcggcctga----------------------------------
A0A2K6N8C5_BAK1-01      ag----cgcggcctgactggcttcctgggccaggtgacccgcttcgtggt
                        *     * **  **                                    

A0A2K6NSH2_BAX-05       ggacttcctccgggagcggct--------gttgggctggatccaagacca
A0A2K6NSH2_BAX-04       ggacttcctccgggagcggct--------gttgggctggatccaagacca
A0A2K6NSH2_BAX-03       ggacttcctccgggagcggct--------gttgggctggatccaagacca
A0A2K6NSH2_BAX-02       ggacttcctccgggagcggct--------gttgggctggatccaagacca
A0A2K6NSH2_BAX-01       ggacttcctccgggagcggct--------gttgggctggatccaagacca
A0A2K6Q8Q6_BOK-01       ggcaacctggctgcggagacgcggtg---gatggactgatgtcctcaaat
A0A2K6N8C5_BAK1-02      cgatttcatgctgcatcactgcattgcccggtggattg-----cacagag
A0A2K6N8C5_BAK1-03      --------------------------------------------------
A0A2K6N8C5_BAK1-01      cgatttcatgctgcatcactgcattgcccggtggattg-----cacagag

A0A2K6NSH2_BAX-05       gggtggttgggtgagactcctcaaccctcct------caccccaaccacc
A0A2K6NSH2_BAX-04       gggtggttgggacggcctcctc--tcctactttgggacgcccacgtggca
A0A2K6NSH2_BAX-03       gggtggttgggacggcctcctc--tcctactttgggacgcccacgtggca
A0A2K6NSH2_BAX-02       gggtggttgggacggcctcctc--tcctactttgggacgcccacgtggca
A0A2K6NSH2_BAX-01       gggtggttgggacggcctcctc--tcctactttgggacgcccacgtggca
A0A2K6Q8Q6_BOK-01       gtgtggt-------cagcacagaccctggcctccgctccc-------act
A0A2K6N8C5_BAK1-02      gggtggctgggtggcagccctgaacttgggcaatggtcccatcctgaacg
A0A2K6N8C5_BAK1-03      --------------------------------------------------
A0A2K6N8C5_BAK1-01      gggtggctgggtggcagccctgaacttgggcaatggtcccatcctgaacg

A0A2K6NSH2_BAX-05       gccc-ctgccccactgtcccttggtg-----------------ccctctc
A0A2K6NSH2_BAX-04       gacc-gtgacc------atcttggtggctggagtactcaccgcctccctc
A0A2K6NSH2_BAX-03       gacc-gtgacc------atcttggtggctggagtactcaccgcctccctc
A0A2K6NSH2_BAX-02       gacc-gtgacc------atcttggtggctggagtactcaccgcctccctc
A0A2K6NSH2_BAX-01       gacc-gtgacc------atcttggtggctggagtactcaccgcctccctc
A0A2K6Q8Q6_BOK-01       ggctggtagct----gcactgtgcagcttcggccgcttcctgaaggctgc
A0A2K6N8C5_BAK1-02      tgctggtggttctgggtgtggttctg-ttgggccagtttgtggtacgaag
A0A2K6N8C5_BAK1-03      --------------------------------------------------
A0A2K6N8C5_BAK1-01      tgctggtggttctgggtgtggttctg-ttgggccagtttgtggtacgaag

A0A2K6NSH2_BAX-05       cccatctttggatcatcagatgtggtctataatgcatttccttacgtgtc
A0A2K6NSH2_BAX-04       accatc--tgga--agaagatggg----------------ctga------
A0A2K6NSH2_BAX-03       accatc--tgga--agaagatggg----------------ctga------
A0A2K6NSH2_BAX-02       accatc--tgga--agaagatggg----------------ctga------
A0A2K6NSH2_BAX-01       accatc--tgga--agaagatggg----------------ctga------
A0A2K6Q8Q6_BOK-01       cttcttcgtgctgctgccagagag----------------atga------
A0A2K6N8C5_BAK1-02      attcttc------------aaatc----------------atga------
A0A2K6N8C5_BAK1-03      --------------------------------------------------
A0A2K6N8C5_BAK1-01      attcttc------------aaatc----------------atga------

A0A2K6NSH2_BAX-05       t
A0A2K6NSH2_BAX-04       -
A0A2K6NSH2_BAX-03       -
A0A2K6NSH2_BAX-02       -
A0A2K6NSH2_BAX-01       -
A0A2K6Q8Q6_BOK-01       -
A0A2K6N8C5_BAK1-02      -
A0A2K6N8C5_BAK1-03      -
A0A2K6N8C5_BAK1-01      -

© 1998-2019